Human TNXB activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	TNXB
Locus ID	7148
Kit Components	GA104937G1, TNXB gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGATCCAAGCTAGAGCAG GA104937G2, TNXB gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGCTGAGAGGAAACCACTG GA104937G3, TNXB gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGACGTGGGAGGTAAGACCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_019105, NM_032470, NM_001365276
Synonyms	EDS3; HXBL; TENX; TN-X; TNX; TNXB1; TNXB2; TNXBS; VUR8; XB; XBS
Summary	This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The tenascins have anti-adhesive effects, as opposed to fibronectin which is adhesive. This protein is thought to function in matrix maturation during wound healing, and its deficiency has been associated with the connective tissue disorder Ehlers-Danlos syndrome. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. It is one of four genes in this cluster which have been duplicated. The duplicated copy of this gene is incomplete and is a pseudogene which is transcribed but does not encode a protein. The structure of this gene is unusual in that it overlaps the CREBL1 and CYP21A2 genes at its 5' and 3' ends, respectively. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.