Human CD229 (LY9) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	LY9
Locus ID	4063
Kit Components	GA102757G1, CD229 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGTGTGTGTCTCAGAGGGA GA102757G2, CD229 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTCTACCTGCCTGCGCAGAT GA102757G3, CD229 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGCAGATGGGAGGAGTCTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001033667, NM_001261456, NM_001261457, NM_002348
Synonyms	CD229; hly9; mLY9; SLAMF3
Summary	LY9 belongs to the SLAM family of immunomodulatory receptors (see SLAMF1; MIM 603492) and interacts with the adaptor molecule SAP (SH2D1A; MIM 300490) (Graham et al., 2006 [PubMed 16365421]).[supplied by OMIM, Mar 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.