Human Filamin B (FLNB) activation kit by CRISPRa
CAT#: GA101626
FLNB CRISPRa kit - CRISPR gene activation of human filamin B
CNY 12,255.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | FLNB |
Locus ID | 2317 |
Kit Components | GA101626G1, Filamin B gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGGCCCGACCCATTCTGTC GA101626G2, Filamin B gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTAGGGCTGCCTGAATCACC GA101626G3, Filamin B gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCGAAGCCCACCACCCCAGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_001164317, NM_001164318, NM_001164319, NM_001457 |
Synonyms | ABP-278; ABP-280; AOI; FH1; FLN-B; FLN1L; LRS1; SCT; TABP; TAP |
Summary | This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN421796 | FLNB - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |