C19orf46 (SYNE4) (NM_001297735) Human Untagged Clone

CAT#: SC335129

SYNE4 (untagged) - Human spectrin repeat containing, nuclear envelope family member 4 (SYNE4), transcript variant 2



  "NM_001297735" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-SYNE4 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C19orf46; DFNB76; KASH4; Nesp4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001297735, the custom clone sequence may differ by one or more nucleotides


ATGGCCCTGTCCCTGCCTCTGGGCCCTAGACTTGGCTCAGAGCCCCTCAACCACCCACCGGGAGCACCTA
GAGAGGCGGACATTGTTGGATGCACCGTCTGCCCCGCGTCCGGAGAGGAGAGCACGAGCCCAGAGCAGGC
CCAGACCCTGGGACAGGACTCCTTGGGCCCTCCTGAGCACTTCCAGGGTGGGCCAAGGGGCAATGAGCCT
GCCGCTCACCCCCCGAGATGGTCAACACCCTCTTCCTACGAGGACCCAGCTGGGGGCAAACACTGTGAGG
TGTTCGAGGAGGCCAACACGCTGGACCAGGACTTGGAGGTCGAGGGAGACTCGGACTGGCCAGGACCTGG
TGGGGTCTGGGGGCCCTGGGCACCCAGTAGCCTCCCCACTTCCACAGAGTTGGAGTGGGATCCGGCGGGG
GACATTGGGGGCCTTGGGCCCTTGGGACAAAAGACAGCCCGGACACTAGGAGTGCCCTGTGAGCTGTGTG
GCCAGAGGGGGCCCCAGGGCAGGGGACAAGGCCTTGAGGAAGCAGACACCTCTCACTCCCGACAGGACAT
GCTGGAGTCTGGCCTCGGCCACCAGAAACGCTTAGCACGTCACCAAAGACACTCCCTGCTCCGGAAGCCT
CAGGACAAGAAGAGGCAAGCATCTCCTCATCTCCAGGATGTGAGGCTGGAGGGGAATCCAGGGGCCCCCG
ATCCTGCATCCAGGCAGCCTCTGACCTTCCTCCTTATCCTCTTCCTCCTCTTCCTCCTCCTGGTGGGTGC
CATGTTTCTCCTGCCCGCGTCAGGAGGCCCCTGCTGCTCTCATGCCCGAATACCCAGGACACCCTACCTG
GTGCTCAGCTATGTCAATGGTCTTCCCCCAGTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001297735
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001297735.2, NP_001284664.1
RefSeq Size 1036 bp
RefSeq ORF 876 bp
Locus ID 163183
UniProt ID Q8N205
Protein Families Transmembrane
Gene Summary This gene is a member of the nesprin family of genes, that encode KASH (Klarsicht, Anc-1, Syne Homology) domain-containing proteins. In addition to the KASH domain, this protein also contains a coiled-coil and leucine zipper region, a spectrin repeat, and a kinesin-1 binding region. This protein localizes to the outer nuclear membrane, and is part of the linker of nucleoskeleton and cytoskeleton (LINC) complex in the nuclear envelope. LINC complexes are formed by SUN (Sad1, UNC-84)-KASH pairs, and are thought to mechanically couple nuclear components to the cytoskeleton. Mutations in this gene have been associated with progressive high-frequency hearing loss. The absence of this protein in mice also caused hearing loss, and changes in hair cell morphology in the ears. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Transcript Variant: This variant (2) lacks two consecutive, alternate in-frame exons in the coding region, compared to variant 1. It encodes isoform 2, which lacks an internal segment and is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...