C19orf46 (SYNE4) (NM_001297735) Human Untagged Clone
CAT#: SC335129
SYNE4 (untagged) - Human spectrin repeat containing, nuclear envelope family member 4 (SYNE4), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C19orf46; DFNB76; KASH4; Nesp4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001297735, the custom clone sequence may differ by one or more nucleotides
ATGGCCCTGTCCCTGCCTCTGGGCCCTAGACTTGGCTCAGAGCCCCTCAACCACCCACCGGGAGCACCTA GAGAGGCGGACATTGTTGGATGCACCGTCTGCCCCGCGTCCGGAGAGGAGAGCACGAGCCCAGAGCAGGC CCAGACCCTGGGACAGGACTCCTTGGGCCCTCCTGAGCACTTCCAGGGTGGGCCAAGGGGCAATGAGCCT GCCGCTCACCCCCCGAGATGGTCAACACCCTCTTCCTACGAGGACCCAGCTGGGGGCAAACACTGTGAGG TGTTCGAGGAGGCCAACACGCTGGACCAGGACTTGGAGGTCGAGGGAGACTCGGACTGGCCAGGACCTGG TGGGGTCTGGGGGCCCTGGGCACCCAGTAGCCTCCCCACTTCCACAGAGTTGGAGTGGGATCCGGCGGGG GACATTGGGGGCCTTGGGCCCTTGGGACAAAAGACAGCCCGGACACTAGGAGTGCCCTGTGAGCTGTGTG GCCAGAGGGGGCCCCAGGGCAGGGGACAAGGCCTTGAGGAAGCAGACACCTCTCACTCCCGACAGGACAT GCTGGAGTCTGGCCTCGGCCACCAGAAACGCTTAGCACGTCACCAAAGACACTCCCTGCTCCGGAAGCCT CAGGACAAGAAGAGGCAAGCATCTCCTCATCTCCAGGATGTGAGGCTGGAGGGGAATCCAGGGGCCCCCG ATCCTGCATCCAGGCAGCCTCTGACCTTCCTCCTTATCCTCTTCCTCCTCTTCCTCCTCCTGGTGGGTGC CATGTTTCTCCTGCCCGCGTCAGGAGGCCCCTGCTGCTCTCATGCCCGAATACCCAGGACACCCTACCTG GTGCTCAGCTATGTCAATGGTCTTCCCCCAGTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001297735 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001297735.2, NP_001284664.1 |
RefSeq Size | 1036 bp |
RefSeq ORF | 876 bp |
Locus ID | 163183 |
UniProt ID | Q8N205 |
Protein Families | Transmembrane |
Gene Summary | This gene is a member of the nesprin family of genes, that encode KASH (Klarsicht, Anc-1, Syne Homology) domain-containing proteins. In addition to the KASH domain, this protein also contains a coiled-coil and leucine zipper region, a spectrin repeat, and a kinesin-1 binding region. This protein localizes to the outer nuclear membrane, and is part of the linker of nucleoskeleton and cytoskeleton (LINC) complex in the nuclear envelope. LINC complexes are formed by SUN (Sad1, UNC-84)-KASH pairs, and are thought to mechanically couple nuclear components to the cytoskeleton. Mutations in this gene have been associated with progressive high-frequency hearing loss. The absence of this protein in mice also caused hearing loss, and changes in hair cell morphology in the ears. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015] Transcript Variant: This variant (2) lacks two consecutive, alternate in-frame exons in the coding region, compared to variant 1. It encodes isoform 2, which lacks an internal segment and is shorter, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237235 | SYNE4 (myc-DDK-tagged) - Human spectrin repeat containing, nuclear envelope family member 4 (SYNE4), transcript variant 2 |
CNY 3,990.00 |
|
RG237235 | SYNE4 (tGFP-tagged) - Human spectrin repeat containing, nuclear envelope family member 4 (SYNE4), transcript variant 2 |
CNY 4,370.00 |