CEACAM7 (NM_001291485) Human Untagged Clone

CAT#: SC334926

CEACAM7 (untagged) - Human carcinoembryonic antigen-related cell adhesion molecule 7 (CEACAM7), transcript variant 2



  "NM_001291485" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CEACAM7 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGM2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001291485, the custom clone sequence may differ by one or more nucleotides


ATGGGGTCCCCTTCAGCCTGTCCATACAGAGTGTGCATTCCCTGGCAGGGGCTCCTGCTCACAGCCTCGC
TTTTAACCTTCTGGAACCTGCCAAACAGTGCCCAGACCAATATTGATGTCGTGCCGTTCAATGTCGCAGA
AGGGAAGGAGGTCCTTCTAGTAGTCCATAATGAGTCCCAGAATCTTTATGGCTACAACTGGTACAAAGGG
GAAAGGGTGCATGCCAACTATCGAATTATAGGATATGTAAAAAATATAAGTCAAGAAAATGCCCCAGGGC
CCGCACACAACGGTCGAGAGACAATATACCCCAATGGAACCCTGCTGATCCAGAACGTCACCCACAATGA
CGCAGGAATCTATACCCTACACGTTATAAAAGAAAATCTTGTGAATGAAGAAGTAACCAGACAATTCTAC
GTATTCTCGGAGCCACCCAAGCCCTCCATCACCAGCAACAACTTCAATCCGGTGGAGAACAAAGATATTG
TGGTTTTAACCTGTCAACCTGAGACTCAGAACACAACCTACCTGTGGTGGGTAAACAATCAGAGCCTCCT
GGTCAGTCCCAGGCTGCTGCTCTCCACTGACAACAGGACCCTCGTTCTACTCAGCGCCACAAAGAATGAC
ATAGGACCCTATGAATGTGAAATACAGAACCCAGTGGGTGCCAGCCGCAGTGACCCAGTCACCCTGAATG
TCCGCTATGAGTCAGTACAAGCAAGTTCACCTGACCTCTCAGCTGGGACCGCTGTCAGCATCATGATTGG
AGTACTGGCTGGGATGGCTCTGATATAG


Restriction Sites SgfI-MluI     
ACCN NM_001291485
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001291485.1, NP_001278414.1
RefSeq Size 2379 bp
RefSeq ORF 798 bp
Locus ID 1087
UniProt ID Q14002
Gene Summary This gene encodes a cell surface glycoprotein and member of the carcinoembryonic antigen (CEA) family of proteins. Expression of this gene may be downregulated in colon and rectal cancer. Additionally, lower expression levels of this gene may be predictive of rectal cancer recurrence. This gene is present in a CEA family gene cluster on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...