VPS29 (NM_001282150) Human Untagged Clone
CAT#: SC334516
VPS29 (untagged) - Human vacuolar protein sorting 29 homolog (S. cerevisiae) (VPS29), transcript variant 3
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DC7; DC15; PEP11 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282150, the custom clone sequence may differ by one or more nucleotides
ATGAGCAGGTGTGCTCTCAGAGGGCGGGATTTGGCGCTTGCAATTGCTGGAACTGTTTCTTTCCACGGGT TGCTACGCCTCTTTAGGGCTGGGCACAGATTGGTGTTGGTATTAGGAGATCTGCACATCCCACACCGGTG CAACAGTTTGCCAGCTAAATTCAAAAAACTCCTGGTGCCAGGAAAAATTCAGCACATTCTCTGCACAGGA AACCTTTGCACCAAAGAGAGTTATGACTATCTCAAGACTCTGGCTGGTGATGTTCATATTGTGAGAGGAG ACTTCGATGAGAATCTGAATTATCCAGAACAGAAAGTTGTGACTGTTGGACAGTTCAAAATTGGTCTGAT CCATGGACATCAAGTTATTCCATGGGGAGATATGGCCAGCTTAGCCCTGTTGCAGAGGCAATTTGATGTG GACATTCTTATCTCGGGACACACACACAAATTTGAAGCATTTGAGCATGAAAATAAATTCTACATTAATC CAGGTTCTGCCACTGGGGCATATAATGCCTTGGAAACAAACATTATTCCATCATTTGTGTTGATGGATAT CCAGGCTTCTACAGTGGTCACCTATGTGTATCAGCTAATTGGAGATGATGTGAAAGTAGAACGAATCGAA TACAAAAAACCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282150 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282150.1, NP_001269079.1 |
RefSeq Size | 1296 bp |
RefSeq ORF | 645 bp |
Locus ID | 51699 |
Gene Summary | This gene belongs to a group of vacuolar protein sorting (VPS) genes that, when functionally impaired, disrupt the efficient delivery of vacuolar hydrolases. The protein encoded by this gene is a component of a large multimeric complex, termed the retromer complex, which is involved in retrograde transport of proteins from endosomes to the trans-Golgi network. This VPS protein may be involved in the formation of the inner shell of the retromer coat for retrograde vesicles leaving the prevacuolar compartment. Alternative splice variants encoding different isoforms and representing non-protein coding transcripts have been found for this gene. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (3) represents the longest transcript and encodes the longest isoform (3). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236622 | VPS29 (myc-DDK-tagged) - Human vacuolar protein sorting 29 homolog (S. cerevisiae) (VPS29), transcript variant 3 |
CNY 2,400.00 |
|
RG236622 | VPS29 (tGFP-tagged) - Human vacuolar protein sorting 29 homolog (S. cerevisiae) (VPS29), transcript variant 3 |
CNY 4,370.00 |