UBE2E3 (NM_001278555) Human Untagged Clone

CAT#: SC334463

UBE2E3 (untagged) - Human ubiquitin-conjugating enzyme E2E 3 (UBE2E3), transcript variant 4



  "NM_001278555" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
UBE2E3 mouse monoclonal antibody, clone OTI7E8 (formerly 7E8)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms UBCH9; UbcM2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001278555, the custom clone sequence may differ by one or more nucleotides


ATGTCCAGTGATAGGCAAAGGTCCGATGATGAGAGCCCCAGCACCAGCAGTGGCAGTTCAGATGCGGACC
AGCGAGACCCAGCCGCTCCAGAGCCTGAAGAACAAGAGGAAAGAAAACCTTCTGCCACCCAGCAGAAGAA
AAACACCAAACTCTCTAGCAAAACCACTGCTAAGTTATCCACTAGTGCTAAAAGAATTCAGAAGGAGCTA
GCTGAAATAACCCTTGATCCTCCTCCTAATTGCAGTGCTGGGCCTAAAGGAGATAACATTTATGAATGGA
GATCAACTATACTTGGTCCACCGGGTTCTGTATATGAAGGTGGTGTGTTTTTTCTGGATATCACATTTTC
ATCAGATTATCCATTTAAGCCACCAAAGGTTACTTTCCGCACCAGAATCTATCACTGCAACATCAACAGT
CAGGGAGTCATCTGTCTGGACATCCTTAAAGACAACTGGAGTCCCGCTTTGACTATTTCAAAGGTTTTGC
TGTCTATTTGTTCCCTTTTGACAGACTGCAACCCTGCGGATCCTCTGGTTGGAAGCATAGCCACTCAGTA
TTTGACCAACAGAGCAGAACACGACAGGATAGCCAGACAGTGGACCAAGAGATACGCAACATAA


Restriction Sites SgfI-MluI     
ACCN NM_001278555
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278555.1, NP_001265484.1
RefSeq Size 1365 bp
RefSeq ORF 624 bp
Locus ID 10477
UniProt ID Q969T4
Protein Pathways Ubiquitin mediated proteolysis
Gene Summary The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein shares 100% sequence identity with the mouse and rat counterparts, which indicates that this enzyme is highly conserved in eukaryotes. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (4) has an alternate 5' UTR exon, compared to variant 1. Variants 1, 2, 3 and 4 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...