ERP27 (NM_001300784) Human Untagged Clone
CAT#: SC334158
ERP27 (untagged) - Human endoplasmic reticulum protein 27 (ERP27), transcript variant 2
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C12orf46; PDIA8 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001300784, the custom clone sequence may differ by one or more nucleotides
ATGAAGGAGACTTGCCAGCTGGAAATACAGGTAGACAATGAACAACTGAATTTAGAGGACGAAGACATTG AAAGCATTGATGCCACCAAATTGAGCCGTTTCATTGAGATCAACAGCCTCCACATGGTGACAGAGTACAA CCCTGTGACTGTGATTGGGTTATTCAACAGCGTAATTCAGATTCATCTCCTCCTGATAATGAACAAGGCC TCCCCAGAGTATGAAGAGAACATGCACAGATACCAGAAGGCAGCCAAGCTCTTCCAGGGGAAGATTCTCT TTATTCTGGTGGACAGTGGTATGAAAGAAAATGGGAAGGTGATATCATTTTTCAAACTAAAGGAGTCTCA ACTGCCAGCTTTGGCAATTTACCAGACTCTAGATGACGAGTGGGATACACTGCCCACAGCAGAAGTTTCC GTAGAGCATGTGCAAAACTTTTGTGATGGATTCCTAAGTGGAAAATTGTTGAAAGAAAATCGTGAATCAG AAGGAAAGACTCCAAAGGTGGAACTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001300784 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001300784.1, NP_001287713.1 |
RefSeq Size | 1388 bp |
RefSeq ORF | 519 bp |
Locus ID | 121506 |
UniProt ID | Q96DN0 |
Gene Summary | This gene encodes a noncatalytic member of the protein disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins. The canonical protein has an N-terminal signal sequence, two thioredoxin (TRX)-like domains and a C-terminal ER-retention sequence. Alternative splicing results in multiple transcript variants encoding distinct isoforms; some of which lack domains present in the canonical protein. [provided by RefSeq, Dec 2016] Transcript Variant: This variant (2) represents use of an alternate promoter, and therefore differs in the 5' UTR and 5' coding region, compared to variant 1. These differences cause translation initiation at an alternate start codon and result in an isoform (2) that has a distinct N-terminus, and is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...