ERP27 (NM_001300784) Human Untagged Clone

CAT#: SC334158

ERP27 (untagged) - Human endoplasmic reticulum protein 27 (ERP27), transcript variant 2



  "NM_001300784" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ERP27 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C12orf46; PDIA8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001300784, the custom clone sequence may differ by one or more nucleotides


ATGAAGGAGACTTGCCAGCTGGAAATACAGGTAGACAATGAACAACTGAATTTAGAGGACGAAGACATTG
AAAGCATTGATGCCACCAAATTGAGCCGTTTCATTGAGATCAACAGCCTCCACATGGTGACAGAGTACAA
CCCTGTGACTGTGATTGGGTTATTCAACAGCGTAATTCAGATTCATCTCCTCCTGATAATGAACAAGGCC
TCCCCAGAGTATGAAGAGAACATGCACAGATACCAGAAGGCAGCCAAGCTCTTCCAGGGGAAGATTCTCT
TTATTCTGGTGGACAGTGGTATGAAAGAAAATGGGAAGGTGATATCATTTTTCAAACTAAAGGAGTCTCA
ACTGCCAGCTTTGGCAATTTACCAGACTCTAGATGACGAGTGGGATACACTGCCCACAGCAGAAGTTTCC
GTAGAGCATGTGCAAAACTTTTGTGATGGATTCCTAAGTGGAAAATTGTTGAAAGAAAATCGTGAATCAG
AAGGAAAGACTCCAAAGGTGGAACTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001300784
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001300784.1, NP_001287713.1
RefSeq Size 1388 bp
RefSeq ORF 519 bp
Locus ID 121506
UniProt ID Q96DN0
Gene Summary This gene encodes a noncatalytic member of the protein disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins. The canonical protein has an N-terminal signal sequence, two thioredoxin (TRX)-like domains and a C-terminal ER-retention sequence. Alternative splicing results in multiple transcript variants encoding distinct isoforms; some of which lack domains present in the canonical protein. [provided by RefSeq, Dec 2016]
Transcript Variant: This variant (2) represents use of an alternate promoter, and therefore differs in the 5' UTR and 5' coding region, compared to variant 1. These differences cause translation initiation at an alternate start codon and result in an isoform (2) that has a distinct N-terminus, and is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...