GNLY (NM_001302758) Human Untagged Clone
CAT#: SC334157
GNLY (untagged) - Human granulysin (GNLY), transcript variant 1
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | D2S69E; LAG-2; LAG2; NKG5; TLA519 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001302758, the custom clone sequence may differ by one or more nucleotides
ATGGCTACCTGGGCCCTCCTGCTCCTTGCAGCCATGCTCCTGGGCAACCCAGGCCTTGAGGTCAGTGTGA GCCCCAAGGGCAAGAACACTTCTGGAAGGGAGAGTGGATTTGGCTGGGCCATCTGGATGGAAGGTCTGGT CTTCTCTCGTCTGAGCCCTGAGTACTACGACCTGGCAAGAGCCCACCTGCGTGATGAGGAGAAATCCTGC CCGTGCCTGGCCCAGGAGGGCCCCCAGGGTGACCTGTTGACCAAAACACAGGAGCTGGGCCGTGACTACA GGACCTGTCTGACGATAGTCCAAAAACTGAAGAAGATGGTGGATAAGCCCACCCAGAGAAGTGTTTCCAA TGCTGCGACCCGGGTGTGTAGGACGGGGAGGTCACGATGGCGCGACGTCTGCAGAAATTTCATGAGGAGG TATCAGTCTAGAGTTACCCAGGGCCTCGTGGCCGGAGAAACTGCCCAGCAGATCTGTGAGGACCTCAGGT TGTGTATACCTTCTACAGGTCCCCTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001302758 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001302758.1, NP_001289687.1 |
RefSeq Size | 924 bp |
RefSeq ORF | 519 bp |
Locus ID | 10578 |
UniProt ID | P22749 |
Protein Families | Secreted Protein |
Gene Summary | The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...