TMEM147 (NM_001242598) Human Untagged Clone

CAT#: SC333971

TMEM147 (untagged) - Human transmembrane protein 147 (TMEM147), transcript variant 3



  "NM_001242598" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to Transmembrane protein 147 (transmembrane protein 147)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NIFIE14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333971 representing NM_001242598.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCCTGTTTCACTTCGGGAACTGCTTCGCTCTTGCCTACTTCCCCTACTTCATCACCTACAAGTGC
AGCGGCCTGTCCGAGTACAACGCCTTCTGGAAATGCGTCCAGGCTGGAGTCACCTACCTCTTTGTCCAA
CTCTGCAAGATGCTGTTCTTGGCCACTTTCTTTCCCACCTGGGAAGGCGGCATCTATGACTTCATTGGG
GTCCATTACATCGTCGCGTCTGCTCAGGTCTGGATGATAACACGCTATGATCTGTACCACACCTTCCGG
CCAGCTGTCCTCCTGCTGATGTTCCTCAGTGTCTACAAGGCCTTTGTTATGGAGACCTTCGTCCACCTC
TGCTCGCTGGGCAGTTGGGCAGCTCTACTGGCCCGAGCAGTGGTAACGGGGCTGCTGGCCCTCAGCACT
TTGGCCCTGTATGTCGCCGTTGTCAATGTGCACTCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001242598
Insert Size 453 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242598.1
RefSeq Size 687 bp
RefSeq ORF 453 bp
Locus ID 10430
Protein Families Druggable Genome, GPCR, Transmembrane
MW 17.1 kDa
Gene Summary Acts as a negative regulator of CHRM3 function, most likely by interfering with its trafficking to the cell membrane (PubMed:21056967). Negatively regulates CHRM3-mediated calcium mobilization and activation of RPS6KA1/p90RSK activity (PubMed:21056967).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks two consecutive exons in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...