CNIH4 (NM_001277197) Human Untagged Clone

CAT#: SC333456

CNIH4 (untagged) - Human cornichon family AMPA receptor auxiliary protein 4 (CNIH4), transcript variant 2



  "NM_001277197" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CNIH-4; CNIH2; HSPC163
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333456 representing NM_001277197.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGCGGTGGTGTTCGTCTTCTCTCTCCTCGATTGTTGCGCGCTCATCTTCCTCTCGGTCTACTTC
ATAATTACATTGTCTGATTTAGAATGTGATTACATTAATGCTAGATCATGTTGCTCAAAATTAAACAAG
TGGGTAATTCCAGAATTGATTGGCCATACCATTGTCACTGTATTACTGCTCATGTCATTGCACTGGTTC
ATCTTCCTTCTCAACTTACCTGTTGCCACTTGGAATATATATCGTATGATCTTAGCTTTGATAAATGAC
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001277197
Insert Size 279 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001277197.1
RefSeq Size 1496 bp
RefSeq ORF 279 bp
Locus ID 29097
UniProt ID Q9P003
Protein Families Transmembrane
MW 10.6 kDa
Gene Summary Involved in G protein-coupled receptors (GPCRs) trafficking from the endoplasmic reticulum to the cell surface; it promotes the exit of GPCRs from the early secretory pathway, likely through interaction with the COPII machinery (PubMed:24405750).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...