TSC22D1 (NM_001243798) Human Untagged Clone

CAT#: SC333425

TSC22D1 (untagged) - Human TSC22 domain family, member 1 (TSC22D1), transcript variant 4



  "NM_001243798" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TSC22D1 mouse monoclonal antibody, clone OTI4H8 (formerly 4H8)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Ptg-2; TGFB1I4; TSC22
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333425 representing NM_001243798.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATCTAGTGAAAAGCCATTTGATGTATGCGGTCAGAGAAGAAGTGGAGGTCCTCAAAGAGCAAATC
AAAGAACTAATAGAGAAAAATTCCCAGCTGGAGCAGGAGAACAATCTGCTGAAGACACTGGCCAGTCCT
GAGCAGCTTGCCCAGTTTCAGGCCCAGCTGCAGACTGGCTCCCCCCCTGCCACCACCCAGCCACAGGGC
ACCACACAGCCCCCCGCCCAGCCAGCATCGCAGGGCTCAGGACCAACCGCATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001243798
Insert Size 261 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243798.1
RefSeq Size 2877 bp
RefSeq ORF 261 bp
Locus ID 8848
Protein Families Transcription Factors
MW 9.4 kDa
Gene Summary This gene encodes a member of the TSC22 domain family of leucine zipper transcription factors. The encoded protein is stimulated by transforming growth factor beta, and regulates the transcription of multiple genes including C-type natriuretic peptide. The encoded protein may play a critical role in tumor suppression through the induction of cancer cell apoptosis, and a single nucleotide polymorphism in the promoter of this gene has been associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a large portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. Variants 3 and 4 encode the same isoform (3), which has a significantly shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...