DYNLT1 (NM_001291603) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CW-1; TCTEL1; tctex-1; TCTEX1
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >SC333406 representing NM_001291603. Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAAGACTACCAGGCTGCGGAGGAGACTGCTTTTGTTGTTGATGAAGTGAGCAACATTGTAAAAGAG GCTATAGAAAGCGCAATTGGTGGTAACGCTTATCAACACAGCAAAGTGAACCAGTGGACCACAAATGTA GTAGAACAAACTTTAAGCCAACTCACCAAGCTGGGAAAACCATTTAAATACATCGAAGAATGGAGCTGG ATTACACACAGCAAGTTCCTGCTTCTGGGACAGCTCTACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites	SgfI-MluI
ACCN	NM_001291603
Insert Size	249 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001291603.1
RefSeq Size	768 bp
RefSeq ORF	249 bp
Locus ID	6993
MW	9.4 kDa
Gene Summary	This gene encodes a component of the motor complex, cytoplasmic dynein, which transports cellular cargo along microtubules in the cell. The encoded protein regulates the length of primary cilia which are sensory organelles found on the surface of cells. The protein encoded by this gene interacts with viral proteins, like the minor capsid protein L2 of human papillomavirus, and is required for dynein-mediated delivery of the viral nucleic acid to the host nucleus. This protein interacts with oncogenic nucleoporins to disrupt gene regulation and cause leukemic transformation. Pseudogenes of this gene are present on chromosomes 4 and 17. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region which results in a frameshift compared to variant 1. The encoded isoform (3) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.