CMTM5 (NM_001288745) Human Untagged Clone

CAT#: SC333362

CMTM5 (untagged) - Human CKLF-like MARVEL transmembrane domain containing 5 (CMTM5), transcript variant 5



  "NM_001288745" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-CMTM5 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CKLFSF5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333362 representing NM_001288745.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTCAGTGCTCGAGATCGCCGGGACCGGCACCCTGAGGAGGGGGTAGTTGCAGAGCTCCAGGGCTTC
GCGGTGGACAAGGCCTTCCTCACCTCCCACAAGGGCATCCTGCTGGAAACCGAGCTGGTTTTTGGCATC
ATCCTGGTTTCCATCTTTGCCTATGATGCCTTCAAGATCTACCGGACTGAGATGGCACCCGGGGCCAGC
CAGGGGGACCAGCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001288745
Insert Size 225 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001288745.1
RefSeq Size 971 bp
RefSeq ORF 225 bp
Locus ID 116173
UniProt ID Q96DZ9
Protein Families Transmembrane
MW 8.3 kDa
Gene Summary This gene encodes a member of the chemokine-like factor superfamily. This family of genes encodes multi-pass membrane proteins that are similar to both the chemokine and the transmembrane 4 superfamilies of signaling molecules. The encoded protein may exhibit tumor suppressor activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (5) lacks two in-frame exons in the central coding region, compared to variant 1. The encoded isoform (e) is shorter, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...