Synaptotagmin VI (SYT6) (NM_001270805) Human Untagged Clone

CAT#: SC333003

SYT6 (untagged) - Homo sapiens synaptotagmin VI (SYT6), transcript variant 3



  "NM_001270805" in other vectors (2)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-SYT6 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms sytVI
Vector pCMV6-Entry
Sequence Data
>SC333003 representing NM_001270805.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCCTGGAGGAACAAGGAGGCCTCCAGTCCCTCTTCTGCTAATCCCCCCTTGGAAGCCCTCCAGAGC
CCCAGCTTCAGAGGCAACATGGCGGACAAGCTGAAGGACCCCAGCACCCTGGGCTTCCTGGAGGCGGCC
GTGAAGATCAGCCACACGTCCCCAGATATCCCAGCTGAGGTGCAGATGTCGGTCAAGGAGCACATCATG
CGTCACACCCGGCTGCAGCGGCAAACTACAGAGCCAGCGTCATCCACCAGGCACACGTCCTTCAAGCGC
CACCTGCCAAGGCAGATGCATGTCTCCAGTGTAGACTATGGCAATGAGCTTCCACCAGCAGCAGAGCAG
CCCACCAGCATTGGCCGCATCAAGCCTGAGCTCTACAAGCAGAAGTCGGTGGATGGGGAGGATGCCAAG
TCTGAGGCCACCAAGAGCTGCGGGAAGATCAACTTCAGCCTACGCTACGATTACGAGACCGAGACCCTG
ATTGTGCGTATCCTGAAGGCTTTTGACCTCCCTGCCAAGGACTTTTGTGGAAGCTCTGACCCTTATGTC
AAGATCTACCTCCTGCCTGACCGCAAATGCAAGCTGCAGACCCGGGTGCACCGCAAGACCCTGAACCCC
ACCTTTGATGAGAACTTCCACTTCCCTGTGCCCTATGAGGAGCTGGCTGACCGCAAGCTGCATCTCAGT
GTCTTCGACTTTGACCGCTTCTCCCGCCATGACATGATTGGCGAGGTCATCCTGGACAACCTCTTTGAG
GCCTCTGACCTGTCTCGGGAAACCTCCATCTGGAAGGATATCCAATATGCCACAAGTGAAAGCGTGGAC
TTGGGAGAGATCATGTTCTCCCTTTGCTACCTGCCCACTGCAGGCAGGCTCACCCTCACAGTGATTAAG
TGTCGGAACCTCAAGGCGATGGACATCACAGGCTATTCAGATCCCTATGTGAAAGTGTCCTTGCTCTGT
GATGGGCGGAGGCTGAAGAAGAAGAAAACAACCATAAAGAAAAACACTCTCAATCCTGTCTACAATGAG
GCCATCATCTTTGACATTCCCCCGGAAAACATGGATCAAGTCAGCCTGCTCATCTCAGTCATGGACTAT
GATCGAGTGGGCCACAATGAGATCATAGGAGTCTGTCGTGTGGGGATCACTGCTGAAGGCCTGGGCAGG
GACCACTGGAACGAGATGCTGGCATACCCCCGGAAGCCCATCGCACACTGGCACTCCTTGGTGGAGGTA
AAGAAATCCTTCAAAGAGGGAAACCCTCGGTTGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001270805
Insert Size 1278 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270805.1
RefSeq Size 4375 bp
RefSeq ORF 1278 bp
Locus ID 148281
UniProt ID Q5T7P8
Protein Families Secreted Protein, Transmembrane
MW 48.4 kDa
Gene Summary The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (3) represents the longer transcript. Variants 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS ID represents the protein described in PMIDs: 11437455 and 16111671. This variant is supported by AK056448.1. It should be noted this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously in PMID: 11437455. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...