TPTE2 (NM_001271850) Human Untagged Clone
CAT#: SC330982
TPTE2 (untagged) - Homo sapiens transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 (TPTE2), transcript variant 5
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | TPIP |
Vector | pCMV6-Entry |
Sequence Data |
>SC330982 representing NM_001271850.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGTTTGTGCCCTCCTTATTGCCTCCGAAATATTTTTAACTGCCGAGGAAAGCCTATATTATTTTGGA GAAAGGCGAACCAATAAAACCCACAGCAATAAATTTCAGGGAGTAGAAACTCCTTCTCAGAATAGATAT GTTGGATATTTTGCACAAGTGAAACATCTCTACAACTGGAATCTCCCTCCAAGACGGATACTCTTTATA AAAAGATTCATTATTTATTCGATTCGTGGTGATGTATGTGATCTAAAAGTCCAAGTAGTAATGGAGAAA AAGGTTGTCTTTTCCAGTACTTCATTAGGAAATTGTTCGATATTGCATGACATTGAAACAGACAAAATA TTAATTAATGTATATGACGGTCCACCTCTGTATGATGATGTGAAAGTGCAGTTTTTCTCTTCGAATCTT CCTAAATACTATGACAATTGTCCATTTTTCTTCTGGTTCAACACGTCTTTTATTCAAAATAACAGGCTT TGTCTACCAAGAAATGAATTGGATAATCCACATAAACAAAAAGCATGGAAAATTTATCCACCAGAATTT GCTGTGGAGATACTTTTTGGCGAGAAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271850 |
Insert Size | 582 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001271850.1 |
RefSeq Size | 1112 bp |
RefSeq ORF | 582 bp |
Locus ID | 93492 |
UniProt ID | Q6XPS3 |
Protein Families | Druggable Genome, Transmembrane |
MW | 22.7 kDa |
Gene Summary | TPIP is a member of a large class of membrane-associated phosphatases with substrate specificity for the 3-position phosphate of inositol phospholipids.[supplied by OMIM, Jul 2002] Transcript Variant: This variant (5) lacks multiple 5' exons but has an alternate segment at the 5' end compared to variant 3. These differences cause translation initiation at a downstream AUG and the resulting isoform (C2) has a much shorter N-terminus, compared to isoform gamma. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232071 | TPTE2 (Myc-DDK tagged) - Homo sapiens transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 (TPTE2), transcript variant 5 |
CNY 3,990.00 |
|
RG232071 | TPTE2 (tGFP-tagged) - Homo sapiens transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 (TPTE2), transcript variant 5 |
CNY 4,370.00 |