TREM2 (NM_001271821) Human Untagged Clone

CAT#: SC330976

TREM2 (untagged) - Homo sapiens triggering receptor expressed on myeloid cells 2 (TREM2), transcript variant 2



  "NM_001271821" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TREM2 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,970.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PLOSL2; TREM-2; Trem2a; Trem2b; Trem2c
Vector pCMV6-Entry
Sequence Data
>SC330976 representing NM_001271821.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGCCTCTCCGGCTGCTCATCTTACTCTTTGTCACAGAGCTGTCCGGAGCCCACAACACCACAGTG
TTCCAGGGCGTGGCGGGCCAGTCCCTGCAGGTGTCTTGCCCCTATGACTCCATGAAGCACTGGGGGAGG
CGCAAGGCCTGGTGCCGCCAGCTGGGAGAGAAGGGCCCATGCCAGCGTGTGGTCAGCACGCACAACTTG
TGGCTGCTGTCCTTCCTGAGGAGGTGGAATGGGAGCACAGCCATCACAGACGATACCCTGGGTGGCACT
CTCACCATTACGCTGCGGAATCTACAACCCCATGATGCGGGTCTCTACCAGTGCCAGAGCCTCCATGGC
AGTGAGGCTGACACCCTCAGGAAGGTCCTGGTGGAGGTGCTGGCAGACCCCCTGGATCACCGGGATGCT
GGAGATCTCTGGTTCCCCGGGGAGTCTGAGAGCTTCGAGGATGCCCATGTGGAGCACAGCATCTCCAGG
GCTGAGAGACACGTGAAGGAAGATGATGGGAGGAAAAGCCCAGGAGAAGTCCCACCAGGGACCAGCCCA
GCCTGCATACTTGCCACTTGGCCACCAGGACTCCTTGTTCTGCTCTGGCAAGAGACTACTCTGCCTGAA
CACTGCTTCTCCTGGACCCTGGAAGCAGGGACTGGTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001271821
Insert Size 660 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271821.1
RefSeq Size 882 bp
RefSeq ORF 660 bp
Locus ID 54209
UniProt ID Q9NZC2
Protein Families Druggable Genome, Secreted Protein, Transmembrane
MW 24.3 kDa
Gene Summary This gene encodes a membrane protein that forms a receptor signaling complex with the TYRO protein tyrosine kinase binding protein. The encoded protein functions in immune response and may be involved in chronic inflammation by triggering the production of constitutive inflammatory cytokines. Defects in this gene are a cause of polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (PLOSL). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (2), alternately referred to as TREM-2V, lacks a 3' coding exon which results in a frameshift, compared to variant 1. The resulting isoform (2) is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...