AKR1CL2 (AKR1E2) (NM_001271021) Human Untagged Clone

CAT#: SC330913

AKR1E2 (untagged) - Homo sapiens aldo-keto reductase family 1, member E2 (AKR1E2), transcript variant 2



  "NM_001271021" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-AKR1CL2 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AKR1CL2; AKRDC1; htAKR; hTSP; HTSP1; LoopADR; TAKR
Vector pCMV6-Entry
Sequence Data
>SC330913 representing NM_001271021.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGAGATATCCCAGCCGTGGGCCTCAGCTCCTGGAAGGCTTCTCCAGGGAAAGTGACCGAGGCAGTG
AAAGAGGCCATTGACGCAGGGTACCGGCACTTCGACTGTGCTTACTTTTACCACAATGAGAGGGAGGTT
GGAGCAGGGATCCGTTGCAAGATCAAGGAAGGCGCTGTAAGACGGGAGGATCTGTTCATTGCCACTAAG
CTGTGGTGCACCTGCCATAAGAAGTCCTTGGTGGAAACAGCATGCAGAAAGAGTCTCAAGGCCTTGAAG
CTGAACTATTTGGACCTCTACCTCATACACTGGCCCATGGGTTTCAAGCCTCCTCATCCAGAATGGATC
ATGAGCTGCAGTGAACTTTCCTTCTGCCTCTCACATCCTCGAGTGCAGGACTTGCCTCTGGACGAGAGC
AACATGGTTATTCCCAGTGACACGGACTTCCTGGACACGTGGGAGGCCATGGAGGACCTGGTGATCACC
GGGCTGGTGAAGAACATCGGGGTGTCAAACTTCAACCATGAACAGCTTGAGAGGCTTTTGAATAAGCCT
GGGTTGAGGTTCAAGCCACTAACCAACCAGATTTTGATCCGATTTCAAATCCAGAGGAATGTGATAGTG
ATCCCCGGATCTATCACCCCAAGTCACATTAAAGAGAATATCCAGGTGTTTGATTTTGAATTAACACAG
CACGATATGGATAACATCCTCAGCCTAAACAGGAATCTCCGACTGGCCATGTTCCCCATAACTAAAAAT
CACAAAGACTATCCTTTCCACATAGAATACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001271021
Insert Size 792 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271021.1
RefSeq Size 1485 bp
RefSeq ORF 792 bp
Locus ID 83592
UniProt ID Q96JD6
Protein Families Druggable Genome
MW 30.3 kDa
Gene Summary The protein encoded by this gene is a member of the aldo-keto reductase superfamily. Members in this family are characterized by their structure (evolutionarily highly conserved TIM barrel) and function (NAD(P)H-dependent oxido-reduction of carbonyl groups). Transcripts of this gene have been reported in specimens of human testis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (2) lacks two alternate in-frame exons in the coding region compared to variant 1. It encodes isoform 2 which is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...