ZFAND2B (NM_001270999) Human Untagged Clone

CAT#: SC330907

ZFAND2B (untagged) - Homo sapiens zinc finger, AN1-type domain 2B (ZFAND2B), transcript variant 3



  "NM_001270999" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ZFAND2B mouse monoclonal antibody, clone OTI1G10 (formerly 1G10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AIRAPL
Vector pCMV6-Entry
Sequence Data
>SC330907 representing NM_001270999.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGTTTCCGGACCTCGGCGCTCACTGTTCGGAGCCGAGCTGTCAGCGCTTGGATTTTCTGCCGCTT
AAGTGTGATGCCTGCTCAGGCATCTTCTGCGCAGACCATGTGGCCTACGCCCAGCATCACTGTGGATCT
GCTTACCAAAAGATCTTCACCAATAAGTGTGAACGCGCTGGCTGCCGGCAGCGAGAAATGATGAAACTG
ACCTGTGAACGCTGTAGCCGAAACTTCTGCATCAAGCACCGGCATCCACTGGACCATGATTGCTCTGGG
GAGGGGCACCCAACCAGCCGGGCAGGACTTGCTGCCATCTCCAGAGCACAAGCTGTGGCTTCTACAAGC
ACTGTCCCCAGCCCAAGTCAAACCATGCCTTCCTGTACCTCTCCCAGCAGAGCCACAACCCGATCTCCG
TCCTGGACAGCCCCTCCAGTGATTGCTTTGCAGAATGGCCTGAGTGAGGATGAAGCTCTGCAGCGGGCC
CTGGAAATGTCCCTGGCAGAAACCAAACCCCAGGTTCCAAGTTGTCAGGAGGAAGAAGACCTAGCTTTA
GCACAAGCACTGTCAGCCAGTGAGGCAGAATACCAGCGGCAGCAGGCCCAGAGCCGCAGCTCGAAGCCG
TCCAACTGCAGCCTGTGCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001270999
Insert Size 642 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270999.1
RefSeq Size 1070 bp
RefSeq ORF 642 bp
Locus ID 130617
UniProt ID Q8WV99
MW 23.2 kDa
Gene Summary This gene encodes a protein containing AN1-type zinc-fingers and ubiquitin-interacting motifs. The encoded protein likely associates with the proteosome to stimulate the degradation of toxic or misfolded proteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (3) differs in the 5' UTR and lacks an alternate in-frame exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...