CDK2AP1 (NM_001270434) Human Untagged Clone

CAT#: SC330834

CDK2AP1 (untagged) - Homo sapiens cyclin-dependent kinase 2 associated protein 1 (CDK2AP1), transcript variant 3



  "NM_001270434" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal CDK2AP1 Antibody
    • 100 ug

CNY 5,302.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms doc-1; DOC1; DORC1; p12DOC-1; ST19
Vector pCMV6-Entry
Sequence Data
>SC330834 representing NM_001270434.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAACGTCTTCACAGTACCGCCAGCTGCTCAGTGACTACGGGCCACCGTCCCTAGGCTACACCCAG
GGAACTGGGAACAGCCAGGTGCCCCAAAGCAAATACGCGGAGCTGCTGGCCATCATTGAAGAGCTGGGG
AAGGAGATCAGACCCACGTACGCAGGGAGCAAGAGTGCCATGGAGAGGCTGAAGCGCGGCATCATTCAC
GCTAGAGGACTGGTTCGGGAGTGCTTGGCAGAAACGGAACGGAATGCCAGATCCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001270434
Insert Size 264 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270434.1
RefSeq Size 1164 bp
RefSeq ORF 264 bp
Locus ID 8099
UniProt ID O14519
MW 9.6 kDa
Gene Summary The protein encoded by this gene is a cyclin-dependent kinase 2 (CDK2) -associated protein which is thought to negatively regulate CDK2 activity by sequestering monomeric CDK2, and targeting CDK2 for proteolysis. This protein was found to also interact with DNA polymerase alpha/primase and mediate the phosphorylation of the large p180 subunit, which suggests a regulatory role in DNA replication during the S-phase of the cell cycle. This protein also forms a core subunit of the nucleosome remodeling and histone deacetylation (NURD) complex that epigenetically regulates embryonic stem cell differentiation. This gene thus plays a role in both cell-cycle and epigenetic regulation. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (3) differs in the 5' UTR and coding region and represents the use of an alternate promoter, compared to variant 1. This difference results in the use of an in-frame downstream start codon and a protein (isoform 2) with a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same protein (isoform 2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...