CDK2AP1 (NM_001270433) Human Untagged Clone
CAT#: SC330833
CDK2AP1 (untagged) - Homo sapiens cyclin-dependent kinase 2 associated protein 1 (CDK2AP1), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | doc-1; DOC1; DORC1; p12DOC-1; ST19 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330833 representing NM_001270433.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCAACGTCTTCACAGTACCGCCAGCTGCTCAGTGACTACGGGCCACCGTCCCTAGGCTACACCCAG GGAACTGGGAACAGCCAGGTGCCCCAAAGCAAATACGCGGAGCTGCTGGCCATCATTGAAGAGCTGGGG AAGGAGATCAGACCCACGTACGCAGGGAGCAAGAGTGCCATGGAGAGGCTGAAGCGCGGCATCATTCAC GCTAGAGGACTGGTTCGGGAGTGCTTGGCAGAAACGGAACGGAATGCCAGATCCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270433 |
Insert Size | 264 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270433.1 |
RefSeq Size | 1136 bp |
RefSeq ORF | 264 bp |
Locus ID | 8099 |
UniProt ID | O14519 |
MW | 9.6 kDa |
Gene Summary | The protein encoded by this gene is a cyclin-dependent kinase 2 (CDK2) -associated protein which is thought to negatively regulate CDK2 activity by sequestering monomeric CDK2, and targeting CDK2 for proteolysis. This protein was found to also interact with DNA polymerase alpha/primase and mediate the phosphorylation of the large p180 subunit, which suggests a regulatory role in DNA replication during the S-phase of the cell cycle. This protein also forms a core subunit of the nucleosome remodeling and histone deacetylation (NURD) complex that epigenetically regulates embryonic stem cell differentiation. This gene thus plays a role in both cell-cycle and epigenetic regulation. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (2) differs in the 5' UTR and coding region and represents the use of an alternate promoter, compared to variant 1. This difference results in the use of an in-frame downstream start codon and a protein (isoform 2) with a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same protein (isoform 2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231592 | CDK2AP1 (Myc-DDK tagged) - Homo sapiens cyclin-dependent kinase 2 associated protein 1 (CDK2AP1), transcript variant 2 |
CNY 3,990.00 |
|
RG231592 | CDK2AP1 (tGFP-tagged) - Homo sapiens cyclin-dependent kinase 2 associated protein 1 (CDK2AP1), transcript variant 2 |
CNY 4,370.00 |
其它CDK2AP1产品