PDCD6 (NM_001267558) Human Untagged Clone

CAT#: SC330760

PDCD6 (untagged) - Homo sapiens programmed cell death 6 (PDCD6), transcript variant 4



  "NM_001267558" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-PDCD6 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALG-2; ALG2; PEF1B
Vector pCMV6-Entry
Sequence Data
>SC330760 representing NM_001267558.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTTGACCGTGAGAACAAGGCCGGCGTGAACTTCAGCGAGTTCACGGGTGTGTGGAAGTACATCACG
GACTGGCAGAACGTCTTCCGCACGTACGACCGGGACAACTCCGGGATGATCGATAAGAACGAGCTGAAG
CAGGCCCTCTCAGGTTTCGGCTACCGGCTCTCTGACCAGTTCCACGACATCCTCATTCGAAAGTTTGAC
AGGCAGGGACGGGGGCAGATTGCCTTCGACGACTTCATCCAGGGCTGCATCGTCCTGCAGAGGTTGACG
GATATATTCAGACGTTACGACACGGATCAGGACGGCTGGATTCAGGTGTCGTACGAACAGTACCTGTCC
ATGGTCTTCAGTATCGTATGA

Restriction Sites SgfI-MluI     
ACCN NM_001267558
Insert Size 366 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001267558.1
RefSeq Size 1066 bp
RefSeq ORF 366 bp
Locus ID 10016
UniProt ID O75340
Protein Families Druggable Genome
MW 14.5 kDa
Gene Summary This gene encodes a calcium-binding protein belonging to the penta-EF-hand protein family. Calcium binding is important for homodimerization and for conformational changes required for binding to other protein partners. This gene product participates in T cell receptor-, Fas-, and glucocorticoid-induced programmed cell death. In mice deficient for this gene product, however, apoptosis was not blocked suggesting this gene product is functionally redundant. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is also located on the short arm of chromosome 5. [provided by RefSeq, May 2012]
Transcript Variant: This variant (4) differs in the 5' UTR and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus, compared to isoform 1. Sequence Note: A downstream translational start codon is selected for this RefSeq based on its better conservation in mammalian species. An upstream in-frame start codon is also present but is poorly conserved; use of the upstream start codon would result in a protein that is 32 aa longer. Leaky scanning by ribosomes may allow translation initiation at the downstream start codon.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...