TAX1BP3 (NM_001204698) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	TIP-1; TIP1
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329763 representing NM_001204698. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCCTACATCCCGGGCCAGCCGGTCACCGCCGTGGTGCAAAGAGTTGAAATTCACAAGCTGCGTCAA GGTGAGAACTTAATCCTGGGTTTCAGCATTGGAGGTGGAATCGACCAGGATCCTTCCCAGAATCCCTTC TCTGAAGACAAGACGGACAAGGTGAACGGCTGGGACATGACCATGGTCACACACGACCAGGCCCGCAAG CGGCTCACCAAGCGCTCGGAGGAGGTGGTGCGTCTGCTGGTGACGCGGCAGTCGCTGCAGAAGGCCGTG CAGCAGTCCATGCTGTCCTAG
Restriction Sites	SgfI-MluI
ACCN	NM_001204698
Insert Size	297 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001204698.1
RefSeq Size	1320 bp
RefSeq ORF	297 bp
Locus ID	30851
UniProt ID	O14907
MW	11 kDa
Gene Summary	This gene encodes a small, highly conserved protein with a single PDZ domain. PDZ (PSD-95/Discs large/ZO-1 homologous) domains promote protein-protein interactions that affect cell signaling, adhesion, protein scaffolding, and receptor and ion transporter functions. The encoded protein interacts with a large number of target proteins that play roles in signaling pathways; for example, it interacts with Rho A and glutaminase L and also acts as a negative regulator of the Wnt/beta-catenin signaling pathway. This protein was first identified as binding to the T-cell leukaemia virus (HTLV1) Tax oncoprotein. Overexpression of this gene has been implicated in altered cancer cell adhesion, migration and metastasis. The encoded protein also modulates the localization and density of inwardly rectifying potassium channel 2.3 (Kir2.3). To date, this protein has been shown to play a role in cell proliferation, development, stress response, and polarization. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Apr 2017] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.