NCOA7 (NM_001199622) Human Untagged Clone

CAT#: SC329537

NCOA7 (untagged) - Homo sapiens nuclear receptor coactivator 7 (NCOA7), transcript variant 6



  "NM_001199622" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
NCOA7 mouse monoclonal antibody,clone OTI1E12
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ187J11.3; ERAP140; ESNA1; Nbla00052; Nbla10993; NCOA7-AS; TLDC4
Vector pCMV6-Entry
Sequence Data
>SC329537 representing NM_001199622.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGAGGCCAAAGATTACCCTTGGACATCCAGATTTTCTATTGTGCCAGACCTGACGAAGAGCCTTTT
GTGAAGATCATCACTGTTGAAGAGGCAAAGCGCAGGAAGAGCACATGCAGCTACTATGAAGACGAGGAC
GAAGAGGTGCTGCCTGTCCTACGGCCCCACAGCGCGCTCCTGGAGAATATGCACATCGAGCAGCTGGCC
CGACGCCTTCCTGCAAGGGTGCAAGGGTATCCATGGAGACTGGCCTATAGCACGTTAGAGCACGGGACC
AGCTTAAAGACGCTCTACCGGAAATCGGCATCACTAGACAGTCCTGTCCTATTGGTCATCAAAGATATG
GATAATCAGATTTTTGGAGCATATGCAACTCATCCTTTCAAGTTCAGTGACCACTATTATGGCACAGGC
GAAACTTTTCTCTACACATTCAGCCCTCATTTTAAGGTCTTTAAGTGGAGTGGAGAAAATTCATACTTT
ATCAATGGAGACATAAGTTCTTTAGAACTTGGTGGTGGAGGGGGACGATTTGGTTTATGGCTAGATGCT
GATTTATACCACGGACGAAGCAACTCTTGCAGCACTTTCAATAATGATATTCTTTCCAAAAAGGAAGAC
TTCATAGTTCAGGATCTGGAGGTGTGGGCATTTGATTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199622
Insert Size 660 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199622.1
RefSeq Size 4052 bp
RefSeq ORF 660 bp
Locus ID 135112
UniProt ID Q8NI08
Protein Families Druggable Genome
MW 25.3 kDa
Gene Summary Enhances the transcriptional activities of several nuclear receptors. Involved in the coactivation of different nuclear receptors, such as ESR1, THRB, PPARG and RARA.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) lacks multiple exons from the 5' end and has an alternate 5' exon, compared to variant 1. The resulting isoform (4) is much shorter and has a distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...