AF10 (MLLT10) (NM_001195630) Human Untagged Clone

CAT#: SC329458

MLLT10 (untagged) - Homo sapiens myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 10 (MLLT10), transcript variant 5



  "NM_001195630" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal MLLT10 (AF10) Antibody (Center)
    • 400 ul

CNY 6,314.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AF10
Vector pCMV6-Entry
Sequence Data
>SC329458 representing NM_001195630.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTCTCTAGCGACCGGCCCGTGTCACTGGAGGACGAGGTCTCCCATAGTATGAAGGAGATGATTGGA
GGCTGTTGCGTTTGCTCAGACGAGAGAGGCTGGGCCGAGAACCCGCTGGTTTATTGCGACGGGCACGGC
TGCAGCGTCGCGGTGCATCAAGCTTGCTATGGCATTGTTCAAGTACCCACTGGACCGTGGTTTTGCAGG
AAATGTGAATCTCAGGAGAGAGCAGCCAGAGTGATGGTATGCAATTCCTGTTGGTTAGCCTCATCTGAA
AACGTCACTCCTGGATACATAGAACATCACTGCGCATGTGCATCTCCCCACCCCCGATGCCTGGTGTCT
AACGTTCCTCCAGTTTCTGGTGCTCTGATGCATTGCTTTTGGGCTTGTCTTACTACAGCAGCTTTCTTC
GGTCCTCAGTCATTTACCACTTGTCATATGTCCTTTCTAGTTTCCAGGGATATTCTTTTTTATATTTAT
GGCTTTATGCCATTTATCTCAGTTGTCATTTGGCGTTTCAAGAAGGAGAGGTGGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001195630
Insert Size 540 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001195630.1
RefSeq Size 1148 bp
RefSeq ORF 540 bp
Locus ID 8028
UniProt ID P55197
Protein Families Druggable Genome, Transcription Factors
MW 20 kDa
Gene Summary This gene encodes a transcription factor and has been identified as a partner gene involved in several chromosomal rearrangements resulting in various leukemias. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
Transcript Variant: This variant (5) has multiple differences in the coding region, compared to variant 1, one of which results in a translational frameshift and early stop codon. The resulting protein (isoform e) has a distinct C-terminus and is shorter than isoform a. Variants 5, 6, and 7 all encode the same isoform (e).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...