AF10 (MLLT10) (NM_001195630) Human Untagged Clone
CAT#: SC329458
MLLT10 (untagged) - Homo sapiens myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 10 (MLLT10), transcript variant 5
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AF10 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329458 representing NM_001195630.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGTCTCTAGCGACCGGCCCGTGTCACTGGAGGACGAGGTCTCCCATAGTATGAAGGAGATGATTGGA GGCTGTTGCGTTTGCTCAGACGAGAGAGGCTGGGCCGAGAACCCGCTGGTTTATTGCGACGGGCACGGC TGCAGCGTCGCGGTGCATCAAGCTTGCTATGGCATTGTTCAAGTACCCACTGGACCGTGGTTTTGCAGG AAATGTGAATCTCAGGAGAGAGCAGCCAGAGTGATGGTATGCAATTCCTGTTGGTTAGCCTCATCTGAA AACGTCACTCCTGGATACATAGAACATCACTGCGCATGTGCATCTCCCCACCCCCGATGCCTGGTGTCT AACGTTCCTCCAGTTTCTGGTGCTCTGATGCATTGCTTTTGGGCTTGTCTTACTACAGCAGCTTTCTTC GGTCCTCAGTCATTTACCACTTGTCATATGTCCTTTCTAGTTTCCAGGGATATTCTTTTTTATATTTAT GGCTTTATGCCATTTATCTCAGTTGTCATTTGGCGTTTCAAGAAGGAGAGGTGGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001195630 |
Insert Size | 540 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001195630.1 |
RefSeq Size | 1148 bp |
RefSeq ORF | 540 bp |
Locus ID | 8028 |
UniProt ID | P55197 |
Protein Families | Druggable Genome, Transcription Factors |
MW | 20 kDa |
Gene Summary | This gene encodes a transcription factor and has been identified as a partner gene involved in several chromosomal rearrangements resulting in various leukemias. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010] Transcript Variant: This variant (5) has multiple differences in the coding region, compared to variant 1, one of which results in a translational frameshift and early stop codon. The resulting protein (isoform e) has a distinct C-terminus and is shorter than isoform a. Variants 5, 6, and 7 all encode the same isoform (e). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231985 | MLLT10 (Myc-DDK tagged) - Homo sapiens myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 10 (MLLT10), transcript variant 5 |
CNY 3,990.00 |
|
RG231985 | MLLT10 (tGFP-tagged) - Homo sapiens myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10), transcript variant 5 |
CNY 4,370.00 |