CYBC1 (NM_001193657) Human Untagged Clone

CAT#: SC329441

C17orf62 (untagged) - Homo sapiens chromosome 17 open reading frame 62 (C17orf62), transcript variant 7



  "NM_001193657" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
C17orf62 mouse monoclonal antibody, clone OTI3B5 (formerly 3B5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C17orf62; CGD5; Eros
Vector pCMV6-Entry
Sequence Data
>SC329441 representing NM_001193657.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTACCTGCAGGTGGAGACCCGCACCAGCTCCCGCCTCCATCTGAAGAGGGCTCCAGGCATCCGGTCC
TGGTCCCTGCTGGTTGGAATCTTGTCGATTGGCCTGGCTGCTGCCTACTACAGCGGAGATAGCCTGGGC
TGGAAGCTCTTCTACGTCACAGGCTGCCTGTTTGTGGCTGTGCAGAACTTGGAGGACTGGGAGGAAGCC
ATCTTCGACAAGAGCACAGGGAAGGTTGTTTTGAAGACGTTCAGCCTCTACAAGAAGCTGCTGACTCTT
TTCAGAGCTGGCCACGACCAGGTGGTGGTCCTGCTCCATGATGTCCGTGATGTGAGCGTGGAGGAGGAG
AAGGTCCGGTACTTCGGGAAAGGCTACATGGTGGTGCTCCGGCTTGCGACGGGCTTCTCCCACCCCCTC
ACGCAGAGTGCAGTCATGGGCCACCGCAGTGATGTGGAAGCCATCGCCAAGCTCATCACCAGCTTCCTG
GAGCTGCACTGCCTTGAGAGCCCCACAGAGCTGTCTCAGAGCAGCGACAGTGAGGCCGGTGACCCTGCA
AGCCAGAGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001193657
Insert Size 564 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001193657.1
RefSeq Size 2384 bp
RefSeq ORF 564 bp
Locus ID 79415
UniProt ID Q9BQA9
Protein Families Transmembrane
MW 20.8 kDa
Gene Summary Necessary for a stable expression of the CYBA and CYBB subunits of the cytochrome b-245 hetrodimer. Controls the phagocyte respiratory burst and is essential for innate immunity.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (7) uses a different splice site in the 5' UTR, compared to variant 1. Variants 1, 4, 5, 6, and 7 all encode isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...