Pregnancy Specific Glycoprotein 1 (PSG1) (NM_001184825) Human Untagged Clone

CAT#: SC328685

PSG1 (untagged)-Human pregnancy specific beta-1-glycoprotein 1 (PSG1) transcript variant 2



  "NM_001184825" in other vectors (2)

CNY 7,220.00


货期*
详询

规格
    • 10 ug

Product images

经常一起买 (4)
PSG1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B1G1; CD66f; DHFRP2; FL-NCA-1/2; PBG1; PS-beta-C/D; PS-beta-G-1; PSBG-1; PSBG1; PSG95; PSGGA; PSGIIA; SP1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001184825, the custom clone sequence may differ by one or more nucleotides
ATGGGAACCCTCTCAGCCCCTCCCTGCACACAGCGCATCAAATGGAAGGGGCTCCTGCTC
ACAGCATCACTTTTAAACTTCTGGAACCTGCCCACCACTGCCCAAGTCACGATTGAAGCC
GAGCCAACCAAAGTTTCCGAGGGGAAGGATGTTCTTCTACTTGTCCACAATTTGCCCCAG
AATCTTACCGGCTACATCTGGTACAAAGGGCAAATGAGGGACCTCTACCATTACATTACA
TCATATGTAGTAGACGGTGAAATAATTATATATGGGCCTGCATATAGTGGACGAGAAACA
GCATATTCCAATGCATCCCTGCTGATCCAGAATGTCACCCGGGAGGACGCAGGATCCTAC
ACCTTACACATCATAAAGGGAGATGATGGGACTAGAGGAGTAACTGGACGTTTCACCTTC
ACCTTACACCTGGAGACTCCTAAGCCCTCCATCTCCAGCAGCAACTTAAATCCCAGGGAG
ACCATGGAGGCTGTGAGCTTAACCTGTGACCCTGAGACTCCAGACGCAAGCTACCTGTGG
TGGATGAATGGTCAGAGCCTCCCTATGACTCACAGCTTGAAGCTGTCCGAAACCAACAGG
ACCCTCTTTCTATTGGGTGTCACAAAGTATACTGCAGGACCCTATGAATGTGAAATACGG
AACCCAGTGAGTGCCAGCCGCAGTGACCCAGTCACCCTGAATCTCCTCCCGAAGCTGCCC
AAGCCCTACATCACCATCAACAACTTAAACCCCAGGGAGAATAAGGATGTCTTAAACTTC
ACCTGTGAACCTAAGAGTGAGAACTACACCTACATTTGGTGGCTAAATGGTCAGAGCCTC
CCGGTCAGTCCCAGGGTAAAGCGACCCATTGAAAACAGGATCCTCATTCTACCCAGTGTC
ACGAGAAATGAAACAGGACCCTATCAATGTGAAATACGGGACCGATATGGTGGCATCCGC
AGTGACCCAGTCACCCTGAATGTCCTCTATGGTCCAGACCTCCCCAGAATTTACCCTTCA
TTCACCTATTACCGTTCAGGAGAAGTCCTCTACTTGTCCTGTTCTGCGGACTCTAACCCA
CCGGCACAGTATTCTTGGACAATTAATGAAAAGTTTCAGCTACCAGGACAAAAGCTCTTT
ATCCGCCATATTACTACAAAGCATAGCGGGCTCTATGTTTGCTCTGTTCGTAACTCAGCC
ACTGGCAAGGAAAGCTCCAAATCCATGACAGTCGAAGTCTCTGACTGGACAGTTCCCTGA
Restriction Sites Please inquire     
ACCN NM_001184825
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001184825.1, NP_001171754.1
RefSeq Size 2071 bp
RefSeq ORF 1260 bp
Locus ID 5669
UniProt ID P11464
Protein Families Secreted Protein
Gene Summary The human placenta is a multihormonal endocrine organ that produces hormones, enzymes, and other molecules that support fetal survival and development. Pregnancy-specific beta-1-glycoprotein (PSBG, PSG) is a major product of the syncytiotrophoblast, reaching concentrations of 100 to 290 mg/l at term in the serum of pregnant women (Horne et al., 1976 [PubMed 971765]). PSG is a member of the immunoglobulin (Ig) superfamily (Watanabe and Chou, 1988 [PubMed 3257488]; Streydio et al., 1988 [PubMed 3260773]).[supplied by OMIM, Oct 2009]
Transcript Variant: This variant (2) contains an alternate 3' terminal exon, compared to variant 4. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 4. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Pregnancy Specific Glycoprotein 1产品

Customer Reviews 
Loading...