RAB35 (NM_001167606) Human Untagged Clone

CAT#: SC328235

RAB35 (untagged)-Human RAB35 member RAS oncogene family (RAB35) transcript variant 2



  "NM_001167606" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-RAB35 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms H-ray; RAB1C; RAY
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328235 representing NM_001167606.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCCGGGACTACGACCACCTCTTCAAGCTGCTCATCATCGGCGACAGCGGTGTGGGCAAGAGCAGT
TTACTGTTGCGTTTTGCAGACAACACTTTCTCAGGCAGCTACATCACCACGATCGGAGTGGATTTCAAG
ATCCGGACCGTGGAGATCAACGGGGAGAAGGTGAAGCTGCAGATCTGGGACACAGCGGGGCAGGAGCGC
TTCCGCACCATCACCTCCACGTATTATCGGGGGACCCACGGGGTCATTGTGGTTTACGACGTCACCAGT
GCCGAGTCCTTTGTCAACGTCAAGCGGTGGCTTCACGAAATCAACCAGAACTGTGATGATGTGTGCCGA
ATATTAGATGTTCAACTGCATCACGGAGCTGGTCCTCCGAGCAAAGAAAGACAACCTGGCAAAACAGCA
GCAGCAACAACAGAACGATGTGGTGAAGCTCACGAAGAACAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001167606
Insert Size 459 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001167606.1
RefSeq Size 2835 bp
RefSeq ORF 459 bp
Locus ID 11021
UniProt ID Q15286
Protein Families Druggable Genome
MW 17.1 kDa
Gene Summary The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. That Rab is involved in the process of endocytosis and is an essential rate-limiting regulator of the fast recycling pathway back to the plasma membrane. During cytokinesis, required for the postfurrowing terminal steps, namely for intercellular bridge stability and abscission, possibly by controlling phosphatidylinositol 4,5-bis phosphate (PIP2) and SEPT2 localization at the intercellular bridge. May indirectly regulate neurite outgrowth. Together with TBC1D13 may be involved in regulation of insulin-induced glucose transporter SLC2A4/GLUT4 translocation to the plasma membrane in adipocytes.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an exon in the 3' coding region, as compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus, as compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...