Ataxin 3 (ATXN3) (NM_001127697) Human Untagged Clone

CAT#: SC327787

ATXN3 (untagged)-Human ataxin 3 (ATXN3) transcript variant e



  "NM_001127697" in other vectors (5)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ATXN3 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AT3; ATX3; JOS; MJD; MJD1; SCA3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC327787 representing NM_001127697.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGTCCATCTTCCACGAGAAACAAGAAGGCTCACTTTGTGCTCAACATTGCCTGAATAACTTATTG
CAAGGAGAATATTTTAGCCCTGTGGAATTATCCTCAATTGCACATCAGCTGGATGAGGAGGAGAGGATG
AGAATGGCAGAAGGAGGAGTTACTAGTGAAGATTATCGCACGTTTTTACAGCAGCCTTCTGGAAATATG
GATGACAGTGGTTTTTTCTCTATTCAGTGGTTTAACTTGAATTCTCTCTTGACGGGTCCAGAATTAATA
TCAGATACATATCTTGCACTTTTCTTGGCTCAATTACAACAGGAAGGTTATTCTATATTTGTCGTTAAG
GGTGATCTGCCAGATTGCGAAGCTGACCAACTCCTGCAGATGATTAGGGTCCAACAGATGCATCGACCA
AAACTTATTGGAGAAGAATTAGCACAACTAAAAGAGCAAAGAGTCCATAAAACAGACCTGGAACGAGTG
TTAGAAGCAAATGATGGCTCAGGAATGTTAGACGAAGATGAGGAGGATTTGCAGAGGGCTCTGGCACTA
AGTCGCCAAGAAATTGACATGGAAGATGAGGAAGCAGATCTCCGCAGGGCTATTCAGCTAAGTATGCAA
GGTAGTTCCAGAAACATATCTCAAGATATGACACAGACATCAGGTACAAATCTTACTTCAGAAGAGCTT
CGGAAGAGACGAGAAGCCTACTTTGAAAAACAGCAGCAAAAGCAGCAACAGCAGCAGCAGCAGCAGCAG
CAGGGGGACCTATCAGGACAGAGTTCACATCCATGTGAAAGGCCAGCCACCAGTTCAGGAGCACTTGGG
AGTGATCTAGGTGATGCTATGAGTGAAGAAGACATGCTTCAGGCAGCTGTGACCATGTCTTTAGAAACT
GTCAGAAATGATTTGAAAACAGAAGGAAAAAAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001127697
Insert Size 933 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001127697.2
RefSeq Size 6770 bp
RefSeq ORF 933 bp
Locus ID 4287
Protein Families Druggable Genome, Transcription Factors
MW 35.1 kDa
Gene Summary Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 12-44 to 52-86 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (e, also known as variant 4) is one of several transcript variants described in figure 2 of Bettencourt et al. (PMID: 19714377). This variant encodes isoform e (also known as isoform 4). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...