CD320 (NM_001165895) Human Untagged Clone
CAT#: SC326807
CD320 (untagged)-Human CD320 molecule (CD320)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 8D6; 8D6A; TCBLR; TCN2R |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001165895, the custom clone sequence may differ by one or more nucleotides
ATGAGCGGCGGTTGGATGGCGCAGGTTGGAGCGTGGCGAACAGGGGCTCTGGGCCTGGCG CTGCTGCTGCTGCTCGGCCTCGGACTAGGCCTGGAGGCCGCCGCGAGCCCGCTTTCCACC CCGACCTCTGCCCAGGCCGCAGGGATTGAGCCATGTACCCAGAAAGGGCAATGCCCACCG CCCCCTGGCCTCCCCTGCCCCTGCACCGGCGTCAGTGACTGCTCTGGGGGAACTGACAAG AAACTGCGCAACTGCAGCCGCCTGGCCTGCCTAGCAGGCGAGCTCCGTTGCACGCTGAGC GATGACTGCATTCCACTCACGTGGCGCTGCGACGGCCACCCAGACTGTCCCGACTCCAGC GACGAGCTCGGCTGTGGAACCAATGAGATCCTCCCGGAAGGGGATGCCACAACCATGGGG CCCCCTGTGACCCTGGAGAGTGTCACCTCTCTCAGGAATGCCACAACCATGGGGCCCCCT GTGACCCTGGAGAGTGTCCCCTCTGTCGGGAATGCCACATCCTCCTCTGCCGGAGACCAG TCTGGAAGCCCAACTGCCTATGGGGTTATTGCAGCTGCTGCGGTGCTCAGTGCAAGCCTG GTCACCGCCACCCTCCTCCTTTTGTCCTGGCTCCGAGCCCAGGAGCGCCTCCGCCCACTG GGGTTACTGGTGGCCATGAAGGAGTCCCTGCTGCTGTCAGAACAGAAGACCTCGCTGCCC |
Restriction Sites | Please inquire |
ACCN | NM_001165895 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001165895.1, NP_001159367.1 |
RefSeq Size | 1157 bp |
RefSeq ORF | 723 bp |
Locus ID | 51293 |
UniProt ID | Q9NPF0 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes the transcobalamin receptor that is expressed at the cell surface. It mediates the cellular uptake of transcobalamin bound cobalamin (vitamin B12), and is involved in B-cell proliferation and immunoglobulin secretion. Mutations in this gene are associated with methylmalonic aciduria. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011] Transcript Variant: This variant (2) lacks an in-frame coding exon compared to variant 1, resulting in a shorter isoform (2) missing an internal protein segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228172 | CD320 (Myc-DDK-tagged)-Human CD320 molecule (CD320), transcript variant 2 |
CNY 3,840.00 |
|
RC228172L3 | Lenti-ORF clone of CD320 (Myc-DDK-tagged)-Human CD320 molecule (CD320), transcript variant 2 |
CNY 5,890.00 |
|
RC228172L4 | Lenti-ORF clone of CD320 (mGFP-tagged)-Human CD320 molecule (CD320), transcript variant 2 |
CNY 5,890.00 |
|
RG228172 | CD320 (tGFP-tagged) - Human CD320 molecule (CD320), transcript variant 2 |
CNY 4,370.00 |