United States
Germany
Japan
United Kingdom
China
FLJ14213 (PRR5L) (NM_001160168) Human Untagged Clone
CAT＃: SC326806
PRR5L (untagged)-Human proline rich 5 like (PRR5L) transcript variant 3
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PROTOR2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001160168, the custom clone sequence may differ by one or more nucleotides
ATGCGGCTGTTGAAGAGTGAACTTGGATCATTCATTACAGACTATTTTCAGAACCAGCTT CTTGCAAAAGGACTGTTCTTTGTGGAGGAGAAGATCAAGCTGTGTGAAGGTGAAAATCGC ATTGAGGTTCTGGCTGAAGTCTGGGACCACTTCTTCACTGAGACTCTCCCTACCCTGCAG GCAATATTTTATCCAGTTCAGAGTGTTCACGAGCCCACAGGCCCAAGTGAGAGTTATTTG CAACTGGAGGAGCTGGTGAAGCAAGTGGTTTCTCCTTTCCTCGGCATCAGCGGGGACCGT AGCTTCTCAGGCCCCACGTACACGCTGGCCAGGCGGCACTCCAGGGTCCGGCCCAAGGTG ACTGTCCTGAACTATGCCTCCCCGATAACCGCAGTCAGCCGGCCACTGAATGAGATGGTC TTGACCCCACTGACAGAGCAGGAGGGGGAAGCCTACCTGGAGAAGTGTGGCAGCGTGCGG CGGCACACGGTGGCCAATGCCCACTCGGACATCCAGCTGCTGGCCATGGCCACCATGATG CACTCGGGCCTGGGGGAGGAGGCCAGCAGTGAGAACAAGTGCCTGCTCCTGCCACCCAGC TTCCCCCCGCCCCACCGGCAGTGCTCCAGTGAGCCCAACATCACTGACAACCCTGACGGA CTGGAGGAGGGGGCCAGGGGCAGCCAGGAGGGCTCGGAGCTGAACTGTGCTTCCCTCAGC |
| Restriction Sites | Please inquire |
| ACCN | NM_001160168 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001160168.1, NP_001153640.1 |
| RefSeq Size | 3378 bp |
| RefSeq ORF | 723 bp |
| Locus ID | 79899 |
| UniProt ID | Q6MZQ0 |
| Gene Summary | Associates with the mTORC2 complex that regulates cellular processes including survival and organization of the cytoskeleton (PubMed:17461779). Regulates the activity of the mTORC2 complex in a substrate-specific manner preventing for instance the specific phosphorylation of PKCs and thereby controlling cell migration (PubMed:22609986). Plays a role in the stimulation of ZFP36-mediated mRNA decay of several ZFP36-associated mRNAs, such as TNF-alpha and GM-CSF, in response to stress (PubMed:21964062). Required for ZFP36 localization to cytoplasmic stress granule (SG) and P-body (PB) in response to stress (PubMed:21964062).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at an alternate AUG and a shorter isoform (b) compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228171 | PRR5L (Myc-DDK-tagged)-Human proline rich 5 like (PRR5L), transcript variant 3 |
CNY 3,990.00 |
|
| RC228171L3 | Lenti-ORF clone of PRR5L (Myc-DDK-tagged)-Human proline rich 5 like (PRR5L), transcript variant 3 |
CNY 5,890.00 |
|
| RC228171L4 | Lenti-ORF clone of PRR5L (mGFP-tagged)-Human proline rich 5 like (PRR5L), transcript variant 3 |
CNY 5,890.00 |
|
| RG228171 | PRR5L (tGFP-tagged) - Human proline rich 5 like (PRR5L), transcript variant 3 |
CNY 4,370.00 |
其它FLJ14213产品
