SETBP1 (NM_001130110) Human Untagged Clone
CAT#: SC325652
SETBP1 (untagged)-Human SET binding protein 1 (SETBP1), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MRD29; SEB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325652 representing NM_001130110.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGTCCAGGGAAACCTTAAGCAGCTCCCGGCAAAGAGGGGGCGAGTCAGACTTCCTGCCGGTCTCC TCAGCCAAGCCCCCAGCTGCTCCTGGCTGTGCAGGAGAACCTTTGCTCTCCACTCCAGGACCTGGGAAG GGGATCCCGGTGGGCGGAGAGCGCATGGAGCCAGAGGAGGAGGATGAACTAGGCTCAGGGCGGGATGTG GATTCCAACTCCAACGCGGACAGTGAGAAATGGGTGGCAGGAGATGGTTTGGAAGAGCAGGAATTTTCT ATCAAGGAGGCAAACTTCACAGAGGGAAGTCTGAAGCTAAAGATTCAGACCACAAAGCGGGCTAAGAAA CCCCCAAAGAATTTGGAGAACTATATATGTCCACCTGAGATCAAGATCACCATCAAGCAGTCTGGGGAC CAGAAGGTGTCCCGTGCTGGAAAAAATAGCAAAGCCACGAAGGAGGAAGAAAGAAGCCACTCCAAAAAG AAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTGACCTCAAAGGATTTCAGCCACAGATTAAAGACTCC AGTAAGGAGGAAGTCTGGAAGAGAAGAGGAGGCCAAGGCATCCCATTCAAAAAGCAATTCCTGTCCCAG GAACGTGCCATGTGCTTCTCATGCCCCCGGAACCCATTCCCCGCAAAACCCGGTTCTCTCACTCTTCCT TTTCACAGTGAACCTGCAGTCTGGGCACAAGAAGTATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001130110 |
Insert Size | 729 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001130110.1 |
RefSeq Size | 1804 bp |
RefSeq ORF | 729 bp |
Locus ID | 26040 |
UniProt ID | Q9Y6X0 |
MW | 26.4 kDa |
Gene Summary | This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (2) differs in the 5' UTR, 3' UTR, and coding region compared to variant 1. The resulting isoform (b) has a shorter and distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225305 | SETBP1 (Myc-DDK-tagged)-Human SET binding protein 1 (SETBP1), transcript variant 2 |
CNY 2,400.00 |
|
RC225305L3 | Lenti ORF clone of Human SET binding protein 1 (SETBP1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225305L4 | Lenti ORF clone of Human SET binding protein 1 (SETBP1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG225305 | SETBP1 (tGFP-tagged) - Human SET binding protein 1 (SETBP1), transcript variant 2 |
CNY 4,370.00 |