CYB561D1 (NM_001134402) Human Untagged Clone
CAT#: SC325553
CYB561D1 (untagged)-Human cytochrome b-561 domain containing 1 (CYB561D1), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001134402, the custom clone sequence may differ by one or more nucleotides
ATGCAGCCCCTGGAGTTCTGCCTCTGCATGGCTGAAGCCATCCTACTCTTCTCACCTGAA CACTCCCTGTTCTTCTTCTGCTCCCGAAAAGCACGGATCCGGCTCCACTGGGCAGGGCAG ACCCTAGCCATCCTCTGTGCAGCTCTGGGCCTGGGCTTCATCATCTCCAGCAGGACCCGC AGTGAGCTGCCTCATCTGGTGTCCTGGCACAGCTGGGTGGGAGCCCTGACACTGCTGGCC ACTGCTGTCCAGGCACTGTGTGGGCTCTGCCTCCTTTGTCCCCGGGCAGCCAGGGTCTCA AGGGTGGCTCGCCTCAAGCTCTACCATCTGACATGTGGACTGGTGGTCTACCTGATGGCT ACAGTAACGGTGCTTCTGGGCATGTACTCAGTATGGTTCCAGGCCCAGATCAAAGGTGCG GCCTGGTACCTGTGCCTGGCACTGCCCGTCTATCCAGCCCTGGTGATCATGCACCAGATT TCCAGATCCTACTTGCCGAGGAAGAAAATGGAAATG |
Restriction Sites | Please inquire |
ACCN | NM_001134402 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001134402.1, NP_001127874.1 |
RefSeq Size | 4816 bp |
RefSeq ORF | 519 bp |
Locus ID | 284613 |
UniProt ID | Q8N8Q1 |
Protein Families | Transmembrane |
Gene Summary | Probable transmembrane reductase that may use ascorbate as an electron donor and transfer electrons across membranes to reduce monodehydro-L-ascorbate radical and iron cations Fe(3+) in another cellular compartment.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) has multiple differences in the 5' UTR and 5' coding region, compared to variant 1. The resulting protein (isoform 3) has a shorter N-terminus when it is compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225175 | CYB561D1 (Myc-DDK-tagged)-Human cytochrome b-561 domain containing 1 (CYB561D1), transcript variant 3 |
CNY 3,990.00 |
|
RC225175L3 | Lenti-ORF clone of CYB561D1 (Myc-DDK-tagged)-Human cytochrome b-561 domain containing 1 (CYB561D1), transcript variant 3 |
CNY 5,890.00 |
|
RC225175L4 | Lenti-ORF clone of CYB561D1 (mGFP-tagged)-Human cytochrome b-561 domain containing 1 (CYB561D1), transcript variant 3 |
CNY 5,890.00 |
|
RG225175 | CYB561D1 (tGFP-tagged) - Human cytochrome b-561 domain containing 1 (CYB561D1), transcript variant 3 |
CNY 4,370.00 |
其它CYB561D1产品