MTRES1 (NM_001142468) Human Untagged Clone

CAT#: SC324823

C6orf203 (untagged)-Human chromosome 6 open reading frame 203 (C6orf203), transcript variant 2



  "NM_001142468" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-C6orf203 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C6orf203; HSPC230; PRED31
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324823 representing NM_001142468.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTATGGCTAGTGTTAAATTGCTTGCCGGTGTTTTAAGAAAGCCAGATGCCTGGATTGGACTCTGG
GGTGTTCTCCGAGGGACACCTTCATCATACAAACTCTGTACTTCCTGGAATCGATACTTGTATTTTTCT
AGTACCAAGTTACGTGCACCAAATTATAAAACACTTTTTTATAATATTTTCTCACTGAGACTCCCAGGG
CTTTTACTATCTCCAGAATGTATTTTTCCTTTTTCCGTAAGACTCAAAAGTAATATAAGGTCTACAAAA
TCTACTAAAAAGTCTCTGCAAAAAGTAGATGAAGAGGACTCTGATGAAGAAAGCCATCATGATGAGATG
AGTGAGCAGGAAGAGGAGCTTGAGGATGATCCTACTGTAGTCAAAAACTATAAAGACCTGGAAAAAGCA
GTTCAGTCTTTTCGGTATGATGTTGTCCTGAAGACGGGGCTAGATATTGGGAGAAACAAAGTGGAAGAT
GCTTTCTACAAAGGTGAACTCAGGCTGAATGAGGAAAAATTATGGAAGAAAAGCAGAACGGTGAAAGTG
GGAGATACATTGGATCTTCTCATTGGAGAGGATAAAGAAGCAGGAACAGAGACAGTTATGCGGATTCTC
TTGAAAAAAGTGTTTGAAGAGAAGACTGAAAGTGAAAAATACAGAGTGGTGTTACGGCGGTGGAAAAGT
TTAAAGTTGCCTAAGAAGAGAATGTCTAAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001142468
Insert Size 723 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001142468.2
RefSeq Size 1725 bp
RefSeq ORF 723 bp
Locus ID 51250
UniProt ID Q9P0P8
MW 27.9 kDa
Gene Summary Mitochondrial RNA-binding protein involved in mitochondrial transcription regulation. Functions as a protective factor to maintain proper mitochondrial RNA level during stress. Acts at the transcription level and its protective function depends on its RNA binding ability.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon, compared to variant 3. Variants 1 and 2 encode the same isoform (a), which has a shorter N-terminus compared to isoform b.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...