RNF24 (NM_001134337) Human Untagged Clone
CAT#: SC324733
RNF24 (untagged)-Human ring finger protein 24 (RNF24), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | G1L |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324733 representing NM_001134337.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGCTCGGATTTCCCACATTACAACTTCAGGATGCCTAATATTGGATTCCAGAATCTGCCTCTCAAC ATATATATTGTGGTTTTTGGTACTGCTATATTTGTCTTCATCCTTAGTTTACTCTTCTGTTGCTACTTG ATTAGGCTAAGACATCAAGCACACAAAGAATTTTATGCCTACAAACAGGTTATATTAAAAGAGAAAGTA AAAGAATTGAATTTACATGAGCTCTGTGCAGTGTGCCTAGAAGACTTCAAGCCTCGAGATGAGTTGGGG ATTTGCCCATGTAAGCACGCCTTCCACAGAAAGTGCCTTATTAAGTGGCTGGAGGTTCGTAAAGTGTGT CCCCTGTGCAACATGCCAGTTCTACAGCTGGCCCAGTTGCACAGTAAGCAGGACCGTGGACCCCCTCAG GGGCCCCTTCCTGGGGCAGAGAACATTGTATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001134337 |
Insert Size | 447 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001134337.2 |
RefSeq Size | 7374 bp |
RefSeq ORF | 447 bp |
Locus ID | 11237 |
UniProt ID | Q9Y225 |
Protein Families | Druggable Genome, Transmembrane |
MW | 17.2 kDa |
Gene Summary | This gene encodes an integral membrane protein that contains a RING-type zinc finger. The encoded protein may interact with multiple transient receptor potential cation channel subfamily C (TRPC) proteins and regulate the trafficking and insertion of these proteins into the plasma membrane. [provided by RefSeq, Mar 2016] Transcript Variant: This variant (2) uses a different segment for its 5' UTR, compared to variant 1. Variants 1, 2 and 4 encode the same isoform (1). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225125 | RNF24 (Myc-DDK-tagged)-Human ring finger protein 24 (RNF24), transcript variant 2 |
CNY 1,200.00 |
|
RC225125L3 | Lenti ORF clone of Human ring finger protein 24 (RNF24), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225125L4 | Lenti ORF clone of Human ring finger protein 24 (RNF24), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG225125 | RNF24 (tGFP-tagged) - Human ring finger protein 24 (RNF24), transcript variant 2 |
CNY 4,370.00 |