SPINK6 (NM_205841) Human Untagged Clone
CAT#: SC321773
SPINK6 (untagged)-Human serine peptidase inhibitor, Kazal type 6 (SPINK6), transcript variant 1
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BUSI2; UNQ844 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_205841.2
GGAAAATGTAGGCTACCAGTAGAAAATGACATTCTCTATTAATAAGATCTGAGGTGCGAC
ACACATAATTGTCCCAATTTTTAAGATTGATGGGGAGCATGAAGCATTTTTTTAATGTGT TGGCAGGCCCCATTAAATGCATAAACTGCATAGGACTCATGTGGTCTGAATGTATTTTAG GGCTTTCTGGGAATTGTCTTGACAGAGAACCTCAGCTGGACAAAGCAGCCTTGATCTGAG TGAGCTAACTGACACAATGAAACTGTCAGGCATGTTTCTGCTCCTCTCTCTGGCTCTTTT CTGCTTTTTAACAGGTGTCTTCAGTCAGGGAGGACAGGTTGACTGTGGTGAGTTCCAGGA CACCAAGGTCTACTGCACTCGGGAATCTAACCCACACTGTGGCTCTGATGGCCAGACATA TGGCAATAAATGTGCCTTCTGTAAGGCCATAGTGAAAAGTGGTGGAAAGATTAGCCTAAA GCATCCTGGAAAATGCTGAGTTAAAGCCAATGTTTCTTGGTGACTTGCCAGCTTTTGCAG CCTTCTTTTCTCACTTCTGCTTATACTTTTGCTGGTGGATTCCTTTAATTCATAAAGACA TACCTACTCTGCCTGGGTCTTGAGGAGTTCAATGTATGTCTATTTCTCTTGATTCACTTG TCAATAAAGTACATTCTGCAAAAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_205841 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_205841.2, NP_995313.2 |
RefSeq Size | 690 bp |
RefSeq ORF | 243 bp |
Locus ID | 404203 |
UniProt ID | Q6UWN8 |
Protein Families | Secreted Protein, Transmembrane |
Gene Summary | The protein encoded by this gene is a Kazal-type serine protease inhibitor that acts on kallikrein-related peptidases in the skin. Two transcript variants the same protein have been found for this gene. [provided by RefSeq, Aug 2010] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204512 | SPINK6 (Myc-DDK-tagged)-Human serine peptidase inhibitor, Kazal type 6 (SPINK6), transcript variant 1 |
CNY 1,200.00 |
|
RC204512L3 | Lenti ORF clone of Human serine peptidase inhibitor, Kazal type 6 (SPINK6), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC204512L4 | Lenti ORF clone of Human serine peptidase inhibitor, Kazal type 6 (SPINK6), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG204512 | SPINK6 (tGFP-tagged) - Human serine peptidase inhibitor, Kazal type 6 (SPINK6), transcript variant 1 |
CNY 2,800.00 |