HNRPH3 (HNRNPH3) (NM_021644) Human Untagged Clone
CAT#: SC317504
HNRNPH3 (untagged)-Human heterogeneous nuclear ribonucleoprotein H3 (2H9) (HNRNPH3), transcript variant 2H9A
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 2H9; HNRPH3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317504 representing NM_021644.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGATTGGGTTATGAAACATAATGGTCCAAATGACGCTAGTGATGGGACAGTACGACTTCGTGGACTA CCATTTGGTTGCAGCAAAGAGGAAATAGTTCAGTTCTTTCAAGGGTTGGAAATCGTGCCAAATGGGATA ACATTGACGATGGACTACCAGGGGAGAAGCACAGGGGAGGCCTTCGTGCAGTTTGCTTCAAAGGAGATA GCAGAAAATGCTCTGGGGAAACACAAGGAAAGAATAGGGCACAGGTATATTGAGATCTTCAGAAGTAGC AGGAGTGAAATCAAAGGATTTTATGATCCACCAAGAAGATTGCTGGGACAGCGACCGGGACCATATGAT AGACCAATAGGAGGAAGAGGGGGTTATTATGGAGCTGGGCGTGGAAGTTATGGAGGTTTTGATGACTAT GGTGGCTATAATAATTACGGCTATGGGAATGATGGCTTTGATGACAGAATGAGAGATGGAAGAGGTATG GGAGGACATGGCTATGGTGGAGCTGGTGATGCAAGTTCAGGTTTTCATGGTGGTCATTTCGTACATATG AGAGGGTTGCCTTTTCGTGCAACTGAAAATGACATTGCTAATTTCTTCTCACCACTAAATCCAATACGA GTTCATATTGATATTGGAGCTGATGGCAGAGCCACAGGAGAAGCAGATGTAGAGTTTGTGACACATGAA GATGCAGTAGCTGCCATGTCTAAAGATAAAAATAACATGCAACATCGATATATTGAACTCTTCTTGAAT TCTACTCCTGGAGGCGGCTCTGGCATGGGAGGTTCTGGAATGGGAGGCTACGGAAGAGATGGAATGGAT AATCAGGGAGGCTATGGATCAGTTGGAAGAATGGGAATGGGGAACAATTACAGTGGAGGATATGGTACT CCTGATGGTTTGGGTGGTTATGGCCGTGGTGGTGGAGGCAGTGGAGGTTACTATGGGCAAGGCGGCATG AGTGGAGGTGGATGGCGTGGGATGTACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_021644 |
Insert Size | 996 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_021644.3 |
RefSeq Size | 2382 bp |
RefSeq ORF | 996 bp |
Locus ID | 3189 |
UniProt ID | P31942 |
Domains | RRM |
MW | 35.2 kDa |
Gene Summary | This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. It is localized in nuclear bodies of the nucleus. This protein is involved in the splicing process and it also participates in early heat shock-induced splicing arrest by transiently leaving the hnRNP complexes. Several alternatively spliced transcript variants have been noted for this gene, however, not all are fully characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2H9A) uses an alternative donor splice site at one of the internal coding exons compared to transcript variant 2H9. However, it maintains the reading frame and encodes an isoform (b) that is missing a 15 aa segment compared to isoform a. Variants 2H9A, 6, 7, 8, and 9 all encode the same isoform (b). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208027 | HNRNPH3 (Myc-DDK-tagged)-Human heterogeneous nuclear ribonucleoprotein H3 (2H9) (HNRNPH3), transcript variant 2H9A |
CNY 2,400.00 |
|
RC208027L3 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein H3 (2H9) (HNRNPH3), transcript variant 2H9A, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC208027L4 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein H3 (2H9) (HNRNPH3), transcript variant 2H9A, mGFP tagged |
CNY 5,890.00 |
|
RG208027 | HNRNPH3 (tGFP-tagged) - Human heterogeneous nuclear ribonucleoprotein H3 (2H9) (HNRNPH3), transcript variant 2H9A |
CNY 4,000.00 |
|
SC109315 | HNRNPH3 (untagged)-Human heterogeneous nuclear ribonucleoprotein H3 (2H9) (HNRNPH3), transcript variant 2H9A |
CNY 5,816.00 |