United States
Germany
Japan
United Kingdom
China
Syntenin 2 (SDCBP2) (NM_080489) Human Untagged Clone
CAT＃: SC317427
SDCBP2 (untagged)-Human syndecan binding protein (syntenin) 2 (SDCBP2), transcript variant 1
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | SITAC; SITAC18; ST-2; ST2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC317427 representing NM_080489.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCATCCCTGTACCCATCTCTAGAGGACCTAAAAGTGGACCAAGCCATTCAGGCCCAGGTCAGAGCC TCACCCAAGATGCCAGCCCTGCCAGTCCAGGCAACAGCCATTTCCCCACCACCAGTTTTGTACCCAAAC TTGGCAGAACTGGAAAATTATATGGGTCTTTCCCTCTCCAGCCAAGAAGTCCAGGAGAGCCTGCTTCAG ATTCCAGAGGGTGACAGTACAGCGGTCTCGGGCCCCGGGCCCGGCCAGATGGTGGCACCGGTAACCGGG TACAGCCTGGGCGTGCGGCGAGCTGAGATCAAGCCCGGGGTGCGCGAGATCCACCTGTGCAAGGACGAG CGCGGCAAGACCGGGCTGAGGCTGCGGAAGGTCGACCAGGGGCTCTTTGTGCAGTTGGTCCAGGCCAAC ACCCCTGCATCCCTTGTGGGGCTGCGCTTTGGGGACCAGCTCCTGCAGATTGACGGGCGTGACTGTGCT GGGTGGAGCTCGCACAAAGCCCATCAGGTGGTGAAGAAGGCATCAGGCGATAAGATTGTCGTGGTGGTT CGGGACAGGCCGTTCCAGCGGACTGTCACCATGCACAAGGACAGCATGGGCCACGTCGGCTTCGTGATC AAGAAGGGGAAGATTGTCTCTCTGGTCAAAGGGAGTTCTGCGGCCCGCAACGGGCTCCTCACCAACCAC TACGTGTGTGAGGTGGACGGGCAGAATGTTATCGGGCTGAAGGACAAAAAGATCATGGAGATTCTGGCC ACGGCTGGGAACGTTGTCACCCTGACCATCATCCCCAGTGTGATCTACGAGCACATGGTCAAAAAGTTG CCTCCAGTCCTGCTCCACCACACCATGGACCACTCCATCCCAGATGCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_080489 |
| Insert Size | 879 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_080489.4 |
| RefSeq Size | 1595 bp |
| RefSeq ORF | 879 bp |
| Locus ID | 27111 |
| UniProt ID | Q9H190 |
| MW | 31.6 kDa |
| Gene Summary | The protein encoded by this gene contains two class II PDZ domains. PDZ domains facilitate protein-protein interactions by binding to the cytoplasmic C-terminus of transmembrane proteins, and PDZ-containing proteins mediate cell signaling and the organization of protein complexes. The encoded protein binds to phosphatidylinositol 4, 5-bisphosphate (PIP2) and plays a role in nuclear PIP2 organization and cell division. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Read-through transcription also exists between this gene and the upstream FKBP1A (FK506 binding protein 1A, 12kDa) gene, as represented in GeneID:100528031. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Both variants 1 and 3 encode the same isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201160 | SDCBP2 (Myc-DDK-tagged)-Human syndecan binding protein (syntenin) 2 (SDCBP2), transcript variant 1 |
CNY 3,600.00 |
|
| RC201160L1 | Lenti ORF clone of Human syndecan binding protein (syntenin) 2 (SDCBP2), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC201160L2 | Lenti ORF clone of Human syndecan binding protein (syntenin) 2 (SDCBP2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC201160L3 | Lenti ORF clone of Human syndecan binding protein (syntenin) 2 (SDCBP2), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC201160L4 | Lenti ORF clone of Human syndecan binding protein (syntenin) 2 (SDCBP2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG201160 | SDCBP2 (tGFP-tagged) - Human syndecan binding protein (syntenin) 2 (SDCBP2), transcript variant 1 |
CNY 5,200.00 |
|
| SC319072 | SDCBP2 (untagged)-Human syndecan binding protein (syntenin) 2 (SDCBP2), transcript variant 1 |
CNY 3,600.00 |
其它Syntenin 2产品
