NSMCE1 (NM_145080) Human Untagged Clone

CAT#: SC317383

NSMCE1 (untagged)-Human non-SMC element 1 homolog (S. cerevisiae) (NSMCE1)



  "NM_145080" in other vectors (5)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal antibody to NSMCE1 (non-SMC element 1 homolog (S. cerevisiae))
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NSE1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317383 representing NM_145080.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGGGCAGCACAAGGAGAATGGGCGTCATGACTGATGTCCACCGGCGCTTCCTCCAGTTGCTGATG
ACCCATGGCGTGCTAGAGGAATGGGACGTGAAGCGCTTGCAGACGCACTGCTACAAGGTCCATGACCGC
AATGCCACCGTAGATAAGTTGGAGGACTTCATCAACAACATTAACAGTGTCTTGGAGTCCTTGTATATT
GAGATAAAGAGAGGAGTCACGGAAGATGATGGGAGACCCATTTATGCGTTGGTGAATCTTGCTACAACT
TCAATTTCCAAAATGGCTACGGATTTTGCAGAGAATGAACTGGATTTGTTTAGAAAGGCTCTGGAACTG
ATTATTGACTCAGAAACCGGCTTTGCGTCTTCCACAAACATATTGAACCTGGTTGATCAACTTAAAGGC
AAGAAGATGAGGAAGAAGGAAGCGGAGCAGGTGCTGCAGAAGTTTGTTCAAAACAAGTGGCTGATTGAG
AAGGAAGGGGAGTTCACCCTGCACGGCCGGGCCATCCTGGAGATGGAGCAATACATCCGGGAGACGTAC
CCCGACGCGGTGAAGATCTGCAATATCTGTCACAGCCTCCTCATCCAGGGTCAAAGCTGCGAAACCTGT
GGGATCAGGATGCACTTACCCTGCGTGGCCAAGTACTTCCAGTCGAATGCTGAACCGCGCTGCCCCCAC
TGCAACGACTACTGGCCCCACGAGATCCCAAAAGTCTTCGACCCTGAGAAGGAGAGGGAGTCTGGTGTC
TTGAAATCGAACAAAAAGTCCCTGCGGTCCAGGCAGCATTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_145080
Insert Size 801 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_145080.3
RefSeq Size 1079 bp
RefSeq ORF 801 bp
Locus ID 197370
UniProt ID Q8WV22
Protein Families Druggable Genome
MW 30.9 kDa
Gene Summary RING-type zinc finger-containing E3 ubiquitin ligase that assembles with melanoma antigen protein (MAGE) to catalyze the direct transfer of ubiquitin from E2 ubiquitin-conjugating enzyme to a specific substrate. Within MAGE-RING ubiquitin ligase complex, MAGE stimulates and specifies ubiquitin ligase activity likely through recruitment and/or stabilization of the E2 ubiquitin-conjugating enzyme at the E3:substrate complex. Involved in maintenance of genome integrity, DNA damage response and DNA repair (PubMed:29225034, PubMed:20864041). NSMCE3/MAGEG1 and NSMCE1 ubiquitin ligase are components of SMC5-SMC6 complex and may positively regulate homologous recombination-mediated DNA repair (PubMed:18086888). MAGEF1-NSMCE1 ubiquitin ligase promotes proteasomal degradation of MMS19, a key component of the cytosolic iron-sulfur protein assembly (CIA) machinery. Down-regulation of MMS19 impairs the activity of several DNA repair and metabolism enzymes such as ERCC2/XPD, FANCJ, RTEL1 and POLD1 that require iron-sulfur clusters as cofactors (PubMed:29225034).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...