GNLY (NM_012483) Human Untagged Clone
CAT#: SC317232
GNLY (untagged)-Human granulysin (GNLY), transcript variant 519
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | D2S69E; LAG-2; LAG2; NKG5; TLA519 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_012483, the custom clone sequence may differ by one or more nucleotides
ATGGAAGGTCTGGTCTTCTCTCGTCTGAGCCCTGAGTACTACGACCTGGCAAGAGCCCAC CTGCGTGATGAGGAGAAATCCTGCCCGTGCCTGGCCCAGGAGGGCCCCCAGGGTGACCTG TTGACCAAAACACAGGAGCTGGGCCGTGACTACAGGACCTGTCTGACGATAGTCCAAAAA CTGAAGAAGATGGTGGATAAGCCCACCCAGAGAAGTGTTTCCAATGCTGCGACCCGGGTG TGTAGGACGGGGAGGTCACGATGGCGCGACGTCTGCAGAAATTTCATGAGGAGGTATCAG TCTAGAGTTACCCAGGGCCTCGTGGCCGGAGAAACTGCCCAGCAGATCTGTGAGGACCTC AGGTTGTGTATACCTTCTACAGGTCCCCTC |
Restriction Sites | Please inquire |
ACCN | NM_012483 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_012483.2, NP_036615.2 |
RefSeq Size | 995 bp |
RefSeq ORF | 393 bp |
Locus ID | 10578 |
UniProt ID | P22749 |
Protein Families | Secreted Protein |
Gene Summary | The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) uses an alternate splice junction in the 5' end and initiates translation at an alternate start codon compared to variant 1. The resulting isoform (3, also known as 519) is shorter at the N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220369 | GNLY (Myc-DDK-tagged)-Human granulysin (GNLY), transcript variant 519 |
CNY 3,990.00 |
|
RC220369L3 | Lenti-ORF clone of GNLY (Myc-DDK-tagged)-Human granulysin (GNLY), transcript variant 519 |
CNY 5,890.00 |
|
RC220369L4 | Lenti-ORF clone of GNLY (mGFP-tagged)-Human granulysin (GNLY), transcript variant 519 |
CNY 5,890.00 |
|
RG220369 | GNLY (tGFP-tagged) - Human granulysin (GNLY), transcript variant 519 |
CNY 4,370.00 |