PSMB11 (NM_001099780) Human Untagged Clone
CAT#: SC316717
PSMB11 (untagged)-Human proteasome (prosome, macropain) subunit, beta type, 11 (PSMB11)
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BETA5T |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001099780 edited
ATGGCTCTGCAGGATGTGTGCAAGTGGCAGTCCCCTGACACCCAGGGACCATCACCTCAC CTGCCTCGGGCTGGCGGCTGGGCTGTGCCCCGGGGTTGTGACCCTCAAACCTTCCTGCAG ATCCATGGCCCCAGACTGGCCCACGGCACCACCACTCTGGCCTTCCGCTTCCGTCATGGA GTCATTGCTGCAGCTGACACGCGTTCCTCCTGTGGCAGCTATGTGGCGTGTCCAGCCTCA TGCAAGGTCATCCCTGTGCACCAGCACCTCCTGGGTACCACCTCTGGCACCTCTGCCGAC TGTGCTACCTGGTATCGGGTATTACAGCGGGAGCTGCGGCTTCGGGAACTGAGGGAGGGT CAGCTGCCCAGTGTGGCCAGTGCTGCCAAGCTCTTGTCAGCCATGATGTCTCAATACCGG GGACTGGATCTCTGTGTGGCCACTGCCCTCTGCGGCTGGGACCGCTCTGGCCCTGAGCTC TTCTACGTCTATAGCGACGGCACCCGCCTGCAGGGGGACATCTTCTCTGTGGGCTCTGGA TCTCCCTATGCCTACGGCGTGCTAGACCGTGGCTATCGCTACGACATGAGCACCCAGGAA GCCTACGCCCTGGCTCGCTGCGCCGTGGCCCACGCCACCCACCGTGATGCCTATTCAGGG GGCTCTGTAGACCTTTTCCACGTGCGGGAGAGTGGATGGGAGCATGTGTCACGCAGTGAT GCCTGTGTGCTGTACGTGGAGTTACAGAAGCTCCTGGAGCCGGAGCCAGAGGAGGATGCC AGCCATGCCCATCCTGAGCCTGCCACTGCCCACAGAGCTGCAGAAGATAGAGAGCTCTCT GTGGGGCCAGGGGAGGTGACACCAGGAGACTCCAGGATGCCAGCAGGGACTGAGACGGTG TGA |
Restriction Sites | Please inquire |
ACCN | NM_001099780 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001099780.1, NP_001093250.1 |
RefSeq Size | 1894 bp |
RefSeq ORF | 903 bp |
Locus ID | 122706 |
UniProt ID | A5LHX3 |
Protein Pathways | Proteasome |
Gene Summary | Proteasomes generate peptides that are presented by major histocompatibility complex (MHC) I molecules to other cells of the immune system. Proteolysis is conducted by 20S proteasomes, complexes of 28 subunits arranged as a cylinder in 4 heteroheptameric rings: alpha-1 to -7, beta-1 to -7, beta-1 to -7, and alpha-1 to -7. The catalytic subunits are beta-1 (PSMB6; MIM 600307), beta-2 (PSMB7; MIM 604030), and beta-5 (PSMB5; MIM 600306). Three additional subunits, beta-1i (PSMB9; MIM 177045), beta-2i (PSMB10; MIM 176847), and beta-5i (PSMB8; MIM 177046), are induced by gamma-interferon (IFNG; MIM 147570) and are preferentially incorporated into proteasomes to make immunoproteasomes. PSMB11, or beta-5t, is a catalytic subunit expressed exclusively in cortical thymic epithelial cells (Murata et al., 2007 [PubMed 17540904]).[supplied by OMIM, Mar 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212390 | PSMB11 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) subunit, beta type, 11 (PSMB11) |
CNY 2,400.00 |
|
RC212390L3 | Lenti ORF clone of Human proteasome (prosome, macropain) subunit, beta type, 11 (PSMB11), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212390L4 | Lenti ORF clone of Human proteasome (prosome, macropain) subunit, beta type, 11 (PSMB11), mGFP tagged |
CNY 5,890.00 |
|
RG212390 | PSMB11 (tGFP-tagged) - Human proteasome (prosome, macropain) subunit, beta type, 11 (PSMB11) |
CNY 4,370.00 |