United States
Germany
Japan
United Kingdom
China
TRAPPC6B (NM_001079537) Human Untagged Clone
CAT＃: SC315477
TRAPPC6B (untagged)-Human trafficking protein particle complex 6B (TRAPPC6B), transcript variant 1
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | NEDMEBA; TPC6 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001079537, the custom clone sequence may differ by one or more nucleotides
ATGGCGGATGAGGCGTTGTTTTTGCTTCTCCATAACGAGATGGTGTCTGGAGTGTACAAG TCCGCGGAGCAGGGGGAGGTGGAAAACGGACGATGTATTACTAAGCTGGAAAACATGGGG TTTCGAGTGGGACAAGGATTGATAGAAAGGTTTACAAAAGATACTGCAAGGTTCAAGGAT GAGTTAGATATCATGAAGTTCATTTGTAAAGATTTTTGGACTACGGTATTCAAGAAACAA ATCGACAATCTAAGGACAAATCATCAGGGCATCTATGTACTTCAGGACAACAAATTTCGC CTGCTTACTCAGATGTCTGCAGGAAAACAGTATTTAGAACATGCATCTAAGTATTTAGCA TTTACGTGTGGCTTAATCAGAGGTGGCTTATCAAACTTGGGAATAAAAAGTATTGTAACA GCTGAAGTGTCTTCAATGCCTGCTTGCAAATTTCAGGTGATGATACAGAAGCTG |
| Restriction Sites | Please inquire |
| ACCN | NM_001079537 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001079537.1, NP_001073005.1 |
| RefSeq Size | 3364 bp |
| RefSeq ORF | 477 bp |
| Locus ID | 122553 |
| UniProt ID | Q86SZ2 |
| Gene Summary | TRAPPC6B is a component of TRAPP complexes, which are tethering complexes involved in vesicle transport (Kummel et al., 2005 [PubMed 16025134]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). CCDS Note: This CCDS ID represents the longer isoform encoded by the TRAPPC6B gene. The shorter isoform is represented by CCDS9670.1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221864 | TRAPPC6B (Myc-DDK-tagged)-Human trafficking protein particle complex 6B (TRAPPC6B), transcript variant 1 |
CNY 3,990.00 |
|
| RC221864L3 | Lenti-ORF clone of TRAPPC6B (Myc-DDK-tagged)-Human trafficking protein particle complex 6B (TRAPPC6B), transcript variant 1 |
CNY 5,890.00 |
|
| RC221864L4 | Lenti-ORF clone of TRAPPC6B (mGFP-tagged)-Human trafficking protein particle complex 6B (TRAPPC6B), transcript variant 1 |
CNY 5,890.00 |
|
| RG221864 | TRAPPC6B (tGFP-tagged) - Human trafficking protein particle complex 6B (TRAPPC6B), transcript variant 1 |
CNY 4,370.00 |
其它TRAPPC6B产品
