TRIM5 alpha (TRIM5) (NM_033093) Human Untagged Clone

CAT#: SC312969

TRIM5 (untagged)-Human tripartite motif containing 5 (TRIM5), transcript variant delta



  "NM_033093" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-TRIM5 Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RNF88; TRIM5alpha
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312969 representing NM_033093.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTTCTGGAATCCTGGTTAATGTAAAGGAGGAGGTGACCTGCCCCATCTGCCTGGAACTCCTGACA
CAACCCCTGAGCCTGGACTGCGGCCACAGCTTCTGCCAAGCATGCCTCACTGCAAACCACAAGAAGTCC
ATGCTAGACAAAGGAGAGAGTAGCTGCCCTGTGTGCCGGATCAGTTACCAGCCTGAGAACATACGGCCT
AATCGGCATGTAGCCAACATAGTGGAGAAGCTCAGGGAGGTCAAGTTGAGCCCAGAGGGGCAGAAAGTT
GATCATTGTGCACGCCATGGAGAGAAACTTCTACTCTTCTGTCAGGAGGACGGGAAGGTCATTTGCTGG
CTTTGTGAGCGGTCTCAGGAGCACCGTGGTCACCACACGTTCCTCACAGAGGAGGTTGCCCGGGAGTAC
CAAGTGAAGCTCCAGGCAGCTCTGGAGATGCTGAGGCAGAAGCAGCAGGAAGCTGAAGAGTTAGAAGCT
GACATCAGAGAAGAGAAAGCTTCCTGGAAGACTCAAATACAGTATGACAAAACCAACGTCTTGGCAGAT
TTTGAGCAACTGAGAGACATCCTGGACTGGGAGGAGAGCAATGAGCTGCAAAACCTGGAGAAGGAGGAG
GAAGACATTCTGAAAAGCCTTACGAACTCTGAAACTGAGATGGTGCAGCAGACCCAGTCCCTGAGAGAG
CTCATCTCAGATCTGGAGCATCGGCTGCAGGGGTCAGTGATGGAGCTGCTTCAGGGTGTGGATGGCGTC
ATAAAAAGGACGGAGAACGTGACCTTGAAGAAGCCAGAAACTTTTCCAAAAAATCAAAGGAGAGTGTTT
CGAGCTCCTGATCTGAAAGGAATGCTAGAAGTGTTTAGAGAGCTGACAGATGTCCGACGCTACTGGGGC
TGGAGTGCAATGGCACGATCTCGGTTCACTGCAACCTCCACCTCTCAGATTCAAGCAATTCTCCTGCCT
CAGCCTCCCAAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_033093
Insert Size 981 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_033093.2
RefSeq Size 2029 bp
RefSeq ORF 981 bp
Locus ID 85363
UniProt ID Q9C035
Protein Families Druggable Genome
MW 37.7 kDa
Gene Summary The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein forms homo-oligomers via the coilel-coil region and localizes to cytoplasmic bodies. It appears to function as a E3 ubiquitin-ligase and ubiqutinates itself to regulate its subcellular localization. It may play a role in retroviral restriction. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Dec 2009]
Transcript Variant: This variant (delta) differs in the 5' UTR and uses an alternate splice site in the 3' terminal exon, which results in a frameshift, compared to variant alpha. The encoded isoform (delta) has a shorter and distinct C-terminus, compared to isoform alpha. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...