ARPC4 (AK024110) Human Untagged Clone
CAT#: SC312201
(untagged)-Human cDNA FLJ14048 fis, clone HEMBA1006650, weakly similar to ARP2/3 COMPLEX 20 KD SUBUNIT
CNY 9,120.00
货期*
4周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AK024110, the custom clone sequence may differ by one or more nucleotides
ATGACTGCCACTCTCCGCCCCTACCTGAGTGCCGTGCGGGCCACATTGCAGGCTGCCCTC TGCCTGGAGAACTTCTCCTCCCAGGTTGTGGAACGACACAACAAGCCGGAAGTGGAAGTC AGGAGTAGCAAAGAGCTCCTGTTACAACCTGTGACCATCAGCAGGAATGGGAAGGAAAAG GTTCTGATTGAGGGCTCCATCAACTCTGTCCGGGTCAGCATTGCTGTGAAACAGGCTGAT GAGATCGAGAAGATTTTGTGCCACAAGTTGAATAGTGCAGGGTGGCCCAGGGCTGCTTCC AGGACTTGCCTGTCCTCCCTGGGTTTGGATGGGAGAGACACAAGGGCCTGGACCTCAGTT TTCTGTTCTCTGCCCCAGCTCAGTGCACCTGTGCAACAACTCCATCCAGAAGCACCTGGA GAACTCATGCCATCGGCATCCACTGCTTCCGCCAGACAACATGTGGTC |
Restriction Sites | Please inquire |
ACCN | AK024110 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | AK024110.1, BAB14828.1 |
RefSeq Size | 1958 bp |
RefSeq ORF | 471 bp |
Locus ID | 10093 |
Protein Pathways | Fc gamma R-mediated phagocytosis, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton |
Gene Summary | This gene encodes one of seven subunits of the human Arp2/3 protein complex. This complex controls actin polymerization in cells and has been conserved throughout eukaryotic evolution. This gene encodes the p20 subunit, which is necessary for actin nucleation and high-affinity binding to F-actin. Alternative splicing results in multiple transcript variants. Naturally occurring read-through transcription exists between this gene and the downstream tubulin tyrosine ligase-like family, member 3 (TTLL3), which results in the production of a fusion protein. [provided by RefSeq, Nov 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...