ARPC4 (AK024110) Human Untagged Clone

CAT#: SC312201

(untagged)-Human cDNA FLJ14048 fis, clone HEMBA1006650, weakly similar to ARP2/3 COMPLEX 20 KD SUBUNIT



CNY 9,120.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ARPC4 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK024110, the custom clone sequence may differ by one or more nucleotides
ATGACTGCCACTCTCCGCCCCTACCTGAGTGCCGTGCGGGCCACATTGCAGGCTGCCCTC
TGCCTGGAGAACTTCTCCTCCCAGGTTGTGGAACGACACAACAAGCCGGAAGTGGAAGTC
AGGAGTAGCAAAGAGCTCCTGTTACAACCTGTGACCATCAGCAGGAATGGGAAGGAAAAG
GTTCTGATTGAGGGCTCCATCAACTCTGTCCGGGTCAGCATTGCTGTGAAACAGGCTGAT
GAGATCGAGAAGATTTTGTGCCACAAGTTGAATAGTGCAGGGTGGCCCAGGGCTGCTTCC
AGGACTTGCCTGTCCTCCCTGGGTTTGGATGGGAGAGACACAAGGGCCTGGACCTCAGTT
TTCTGTTCTCTGCCCCAGCTCAGTGCACCTGTGCAACAACTCCATCCAGAAGCACCTGGA
GAACTCATGCCATCGGCATCCACTGCTTCCGCCAGACAACATGTGGTC
Restriction Sites Please inquire     
ACCN AK024110
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq AK024110.1, BAB14828.1
RefSeq Size 1958 bp
RefSeq ORF 471 bp
Locus ID 10093
Protein Pathways Fc gamma R-mediated phagocytosis, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton
Gene Summary This gene encodes one of seven subunits of the human Arp2/3 protein complex. This complex controls actin polymerization in cells and has been conserved throughout eukaryotic evolution. This gene encodes the p20 subunit, which is necessary for actin nucleation and high-affinity binding to F-actin. Alternative splicing results in multiple transcript variants. Naturally occurring read-through transcription exists between this gene and the downstream tubulin tyrosine ligase-like family, member 3 (TTLL3), which results in the production of a fusion protein. [provided by RefSeq, Nov 2010]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...