RSPO4 (NM_001040007) Human Untagged Clone

CAT#: SC311064

RSPO4 (untagged)-Human R-spondin family, member 4 (RSPO4), transcript variant 2



  "NM_001040007" in other vectors (6)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C20orf182; CRISTIN4
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001040007 edited
GCCCTTGCCCGGATCCGGCTGCCCAGATGCGGGCGCCACTCTGCCTGCTCCTGCTCGTCG
CCCACGCCGTGGACATGCTCGCCCTGAACCGAAGGAAGAAGCAAGTGGGCACTGGCCTGG
GGGGCAACTGCACAGGCTGTATCATCTGCTCAGAGGAGAACGGCTGTTCCACCTGCCAGC
AGAGGCTCTTCCTGTTCATCCGCCGGGAAGGCATCCGCCAGTACGGCAAGTGCCTGCACG
ACTGTCCCCCTGGGTACTTCGGCATCCGCGGCCAGGAGGTCAACAGGTGC:AAAAAATGT
GGGGCCACTTGTGAGAGCTGCTTCAGCCAGGACTTCTGCATCCGGTGCAAGAGGCAGTTT
TACTTGTACAAGGGGAAGTGTCTGCCCACCTGCCCGCCGGGCACTTTGGCCCACCAGAAC
ACACGGGAGTGCCAGGAGAGGAGCCCCGGCCAGAAGAAGGGCAGGAAGGACCGGCGCCCA
CGCAAGGACAGGAAGCTGGACCGCAGGCTGGACGTGAGGCCGCGCCAGCCCGGCCTGCAG
CCCTGACCGCCGGCTCTCCCGACTCTCTGGTCCTAGTCCTCGGAAGGGC
Restriction Sites Please inquire     
ACCN NM_001040007
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001040007.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001040007.1, NP_001035096.1
RefSeq Size 2536 bp
RefSeq ORF 519 bp
Locus ID 343637
UniProt ID Q2I0M5
Protein Families Secreted Protein
Gene Summary This gene encodes a member of the R-spondin family of proteins that share a common domain organization consisting of a signal peptide, cysteine-rich/furin-like domain, thrombospondin domain and a C-terminal basic region. The encoded protein may be involved in activation of Wnt/beta-catenin signaling pathways. Mutations in this gene are associated with anonychia congenital. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2009]
Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...