CKLF (NM_001040138) Human Untagged Clone
CAT#: SC310914
CKLF (untagged)-Human chemokine-like factor (CKLF), transcript variant 5
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C32; CKLF1; CKLF2; CKLF3; CKLF4; HSPC224; UCK-1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001040138, the custom clone sequence may differ by one or more nucleotides
ATGGATAACGTGCAGCCGAAAATAAAACATCGCCCCTTCTGCTTCAGTGTGAAAGGCCAC GTGAAGATGCTGCGGCTGGCACTAACTGTGACATCTATGACCTTTTTTATCATCGCACAA GCCCCTGAACCATATATTGTTATCACTGGATTTGAAGTCACCGTTATCTTATTTTTCATA CTTTTATATGTACTCAGACTTGATCGATTAATGAAGTGGTTATTTTGGCCTTTGCTTGAT ATTATCAACTCACTGGTAACAACAGTATTCATGCTCATCGTATCTGTGTTGGCACTGATA CCAGAAACCACAACATTGACAGTTGGTGGAGGGTTATTTTAA |
Restriction Sites | Please inquire |
ACCN | NM_001040138 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001040138.1, NP_001035228.1 |
RefSeq Size | 655 bp |
RefSeq ORF | 342 bp |
Locus ID | 51192 |
UniProt ID | Q9UBR5 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Gene Summary | The product of this gene is a cytokine. Cytokines are small proteins that have an essential role in the immune and inflammatory responses. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 16. The protein encoded by this gene is a potent chemoattractant for neutrophils, monocytes and lymphocytes. It also can stimulate the proliferation of skeletal muscle cells. This protein may play important roles in inflammation and in the regeneration of skeletal muscle. Alternatively spliced transcript variants encoding different isoforms have been identified. Naturally occurring read-through transcription occurs between this locus and the neighboring locus CMTM1 (CKLF-like MARVEL transmembrane domain containing 1).[provided by RefSeq, Feb 2011] Transcript Variant: This variant (5) differs in the coding region and 3' UTR, compared to variant 1. The encoded isoform (e) is shorter and contains a unique C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222344 | CKLF (Myc-DDK-tagged)-Human chemokine-like factor (CKLF), transcript variant 5 |
CNY 3,990.00 |
|
RC222344L3 | Lenti-ORF clone of CKLF (Myc-DDK-tagged)-Human chemokine-like factor (CKLF), transcript variant 5 |
CNY 5,890.00 |
|
RC222344L4 | Lenti-ORF clone of CKLF (mGFP-tagged)-Human chemokine-like factor (CKLF), transcript variant 5 |
CNY 5,890.00 |
|
RG222344 | CKLF (tGFP-tagged) - Human chemokine-like factor (CKLF), transcript variant 5 |
CNY 4,370.00 |