GAGE5 (NM_001475) Human Untagged Clone

CAT#: SC309040

GAGE5 (untagged)-Human G antigen 5 (GAGE5)



  "NM_001475" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT4.5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001475 edited
CCGGGATCTGTGAGGCAGTGCTGTGTGGTTCCTGCCGTCCGGACTCTTTTTCCTCTACTG
AGATTCATCTGTGTGAAATATGAGTTGGCGAGGAAGATCGACCTATTATTGGCCTAGACC
AAGGCGCTATGTACAGCCTCCTGAAGTGATTGGGCCTATGCGGCCCGAGCAGTTCAGTGA
TGAAGTGGAACCAGCAACACCTGAAGAAGGGGAACCAGCAACTCAACGTCAGGATCCTGC
AGCTGCTCAGGAGGGAGAGGATGAGGGAGCATCTGCAGGTCAAGGGCCGAAGCCTGAAGC
TGATAGCCAGGAACAGGGTCACCCACAGACTGGGTGTGAGTGTGAAGATGGTCCTGATGG
GCAGGAGATGGACCCGCCAAATCCAGAGGAGGTGAAAACGCCTGAAGAAGGTGAAAAGCA
ATCACAGTGTTAAAAGAAGGCACGTTGAAATGATGCAGGCTGCTCCTATGTTGGAAATTT
GTTCATTAAAATTCTCCCAATAAAGCTTTACAGCCTTCTGC
Restriction Sites Please inquire     
ACCN NM_001475
Insert Size 500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_001475.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001475.1, NP_001466.1
RefSeq Size 524 bp
RefSeq ORF 354 bp
Locus ID 2577
UniProt ID Q13069
Gene Summary This gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The sequences of the family members are highly related but differ by scattered nucleotide substitutions. The antigenic peptide YYWPRPRRY, which is also encoded by several other family members, is recognized by autologous cytolytic T lymphocytes. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...