STOM (NM_198194) Human Untagged Clone

CAT#: SC307644

STOM (untagged)-Human stomatin (STOM), transcript variant 2



  "NM_198194" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
STOM Antibody - C-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BND7; EPB7; EPB72
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_198194, the custom clone sequence may differ by one or more nucleotides
ATGGCCGAGAAGCGGCACACACGGGACTCCGAAGCCCAGCGGCTCCCCGACTCCTTCAAG
GACAGCCCCAGTAAGGGCCTTGGACCTTGCGGATGGATTTTGGTGGCGTTCTCATTCTTA
TTCACCGTTATAACTTTCCCAATCTCAATATGGATGTGCATAAAGGTTATTGCAGCCGAA
GGAGAAATGAATGCATCCAGGGCTCTGAAAGAAGCCTCCATGGTCATCACTGAATCTCCT
GCAGCCCTTCAGCTCCGATACCTGCAGACACTGACCACCATTGCTGCTGAGAAAAACTCA
ACAATTGTCTTCCCTCTGCCCATAGATATGCTGCAAGGAATCATAGGGGCAAAACACAGC
CATCTAGGCTAG
Restriction Sites Please inquire     
ACCN NM_198194
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_198194.1, NP_937837.1
RefSeq Size 2593 bp
RefSeq ORF 372 bp
Locus ID 2040
UniProt ID P27105
Protein Families Transmembrane
Gene Summary This gene encodes a member of a highly conserved family of integral membrane proteins. The encoded protein localizes to the cell membrane of red blood cells and other cell types, where it may regulate ion channels and transporters. Loss of localization of the encoded protein is associated with hereditary stomatocytosis, a form of hemolytic anemia. There is a pseudogene for this gene on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (2) lacks several alternate exons in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...