KRTAP21-1 (NM_181619) Human Untagged Clone
CAT#: SC307329
KRTAP21 (untagged)-Human keratin associated protein 21-1 (KRTAP21-1)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | KAP21.1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC307329 representing NM_181619.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTGTTGCAACTACTACGGCAACTCCTGTGGCTATGGCTCCGGCTGTGGCTGTGGCTATGGCTCTGGC TCTGGCTGTGGCTGTGGCTATGGAACTGGCTATGGCTGTGGGTATGGCTGTGGGTTTGGCTCCCATTAT GGCTGTGGTTATGGAACTGGCTATGGCTGTGGATATGGCTCTGGCTCTGGCTACTGTGGCTACCGGCCA TTTTGCTTTAGAAGATGCTATTCTTCCTGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_181619 |
Insert Size | 240 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_181619.1 |
RefSeq Size | 240 bp |
RefSeq ORF | 240 bp |
Locus ID | 337977 |
UniProt ID | Q3LI58 |
MW | 7.9 kDa |
Gene Summary | In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211238 | KRTAP21 (Myc-DDK-tagged)-Human keratin associated protein 21-1 (KRTAP21-1) |
CNY 1,200.00 |
|
RC211238L3 | Lenti-ORF clone of KRTAP21 (Myc-DDK-tagged)-Human keratin associated protein 21-1 (KRTAP21-1) |
CNY 5,890.00 |
|
RC211238L4 | Lenti-ORF clone of KRTAP21 (mGFP-tagged)-Human keratin associated protein 21-1 (KRTAP21-1) |
CNY 5,890.00 |
|
RG211238 | KRTAP21 (tGFP-tagged) - Human keratin associated protein 21-1 (KRTAP21-1) |
CNY 4,370.00 |
其它KRTAP21-1产品