United States
Germany
Japan
United Kingdom
China
Frataxin (FXN) (NM_181425) Human Untagged Clone
CAT＃: SC307276
FXN (untagged)-Human frataxin (FXN), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CyaY; FA; FARR; FRDA; X25 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_181425, the custom clone sequence may differ by one or more nucleotides
ATGTGGACTCTCGGGCGCCGCGCAGTAGCCGGCCTCCTGGCGTCACCCAGCCCAGCCCAG GCCCAGACCCTCACCCGGGTCCCGCGGCCGGCAGAGTTGGCCCCACTCTGCGGCCGCCGT GGCCTGCGCACCGACATCGATGCGACCTGCACGCCCCGCCGCGCAAGTTCGAACCAACGT GGCCTCAACCAGATTTGGAATGTCAAAAAGCAGAGTGTCTATTTGATGAATTTGAGGAAA TCTGGAACTTTGGGCCACCCAGGCTCTCTAGATGAGACCACCTATGAAAGACTAGCAGAG GAAACGCTGGACTCTTTAGCAGAGTTTTTTGAAGACCTTGCAGACAAGCCATACACGTTT GAGGACTATGATGTCTCCTTTGGGAGTGGTGTCTTAACTGTCAAACTGGGTGGAGATCTA GGAACCTATGTGATCAACAAGCAGACGCCAAACAAGCAAATCTGGCTATCTTCTCCATCC AGGTATGTAGTGGACCTAAGCGTTATGACTGGACTGGGAAAAACTGGGTGTACTCCCACG ACGGCGTGTCCCTCCATGAGCTGCTGGCCGCAGAGCTCACTAAAGCCTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_181425 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_181425.1, NP_852090.1 |
| RefSeq Size | 2270 bp |
| RefSeq ORF | 591 bp |
| Locus ID | 2395 |
| UniProt ID | Q16595 |
| Protein Families | Druggable Genome |
| Gene Summary | This nuclear gene encodes a mitochondrial protein which belongs to the FRATAXIN family. The protein functions in regulating mitochondrial iron transport and respiration. The expansion of intronic trinucleotide repeat GAA from 8-33 repeats to >90 repeats results in Friedreich ataxia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a frameshift. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219677 | FXN (Myc-DDK-tagged)-Human frataxin (FXN), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 3,990.00 |
|
| RC219677L3 | Lenti-ORF clone of FXN (Myc-DDK-tagged)-Human frataxin (FXN), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
| RC219677L4 | Lenti-ORF clone of FXN (mGFP-tagged)-Human frataxin (FXN), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
| RG219677 | FXN (tGFP-tagged) - Human frataxin (FXN), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,370.00 |
